News Reader.info

ABSTRACT Molecular chaperones such as Hsp40 and Hsp70 hold the androgen receptor (AR) in an inactive conformation. They are released in the presence of androgens, enabling transactivation

and causing the receptor to become aggregation-prone. Here we show that these molecular chaperones recognize a region of the AR N-terminal domain (NTD), including a FQNLF motif, that

interacts with the AR ligand-binding domain (LBD) upon activation. This suggests that competition between molecular chaperones and the LBD for the FQNLF motif regulates AR activation. We

also show that, while the free NTD oligomerizes, binding to Hsp70 increases its solubility. Stabilizing the NTD-Hsp70 interaction with small molecules reduces AR aggregation and promotes its

degradation in cellular and mouse models of the neuromuscular disorder spinal bulbar muscular atrophy. These results help resolve the mechanisms by which molecular chaperones regulate the

balance between AR aggregation, activation and quality control. SIMILAR CONTENT BEING VIEWED BY OTHERS LARGE-SCALE, IN-CELL PHOTOCROSSLINKING AT SINGLE-RESIDUE RESOLUTION REVEALS THE

MOLECULAR BASIS FOR GLUCOCORTICOID RECEPTOR REGULATION BY IMMUNOPHILINS Article 09 November 2023 CRYO-EM REVEALS HOW HSP90 AND FKBP IMMUNOPHILINS CO-REGULATE THE GLUCOCORTICOID RECEPTOR

Article Open access 09 November 2023 GLUCOCORTICOID RECEPTOR COMPLEXES FORM COOPERATIVELY WITH THE HSP90 CO-CHAPERONES PP5 AND FKBPS Article Open access 01 July 2020 INTRODUCTION Molecular

chaperones are key components of the protein quality control system. In addition to their well-known roles in protein folding and degradation1,2, they also stabilize specific conformations

of proteins to enable the fast and efficient relay of signaling information. This aspect of their function is exemplified by their activity on steroid hormone receptors (SHRs), such as the

glucocorticoid receptor (GR) and the androgen receptor (AR). It is known that a complex of heat shock proteins, including Hsp90, Hsp70, HOP, and Hsp40, is required to stabilize an inactive

SHR conformation3,4. This activity is termed a holdase function because the apo-receptor is held in a structural state that is stable, soluble and prepared for binding to ligands5. Hormone

binding then shifts the SHR into a distinct conformer of lower solubility that gains affinity for DNA and is capable of activating transcription. Intriguingly, at least some of the members

of the chaperone machinery become more transiently associated with the SHR during this process6, suggesting that these complexes are dynamic and play a role in stabilizing the conformation

of the active receptor. In addition, a subset of the chaperones, including Hsp70, is also required for SHR turnover, through recruitment of E3 ubiquitin ligases7. Thus, the SHR system

provides an excellent model for understanding how molecular chaperones balance the needs of protein folding, stability, function and quality control. Pioneering studies by Pratt et al. have

revealed the order of chaperone binding and release from SHRs3,4 and defined the importance of their individual functions in cell-free systems and in cells8. In support of this notion, a

recent study showed that Hsp70, HOP, and Hsp90 bind to the ligand-binding domain (LBD) of GR9, holding it in a stable, open conformation. However, it is unknown whether this mechanism is

conserved in other nuclear receptors; indeed, the Buchner group recently found that different Hsp90 co-chaperones are required for activating GR when compared to AR10. In addition the

structural roles of the chaperones during SHR activation and turnover are also not clear: for example, it has been proposed that Hsp70 interactions with the LBD are involved in receptor

triage11,12, but chemical modulators of Hsp70 or Hsp40 induce ubiquitin-dependent degradation of AR variants that lack the LBD13. These observations suggest that some chaperones, especially

Hsp70 and Hsp40, may have additional binding sites outside the canonical LBD region and that these might be critical for homeostasis of some SHRs. A mechanistic knowledge of how SHRs are

regulated by chaperones is also important for better understanding their roles in disease. For example, AR is an important therapeutic target for prostate cancer, because it controls the

expression of genes associated with proliferation14,15 in response to androgens, such as dihydrotestosterone (DHT)16. AR is also clinically important in spinal and bulbar muscular atrophy

(SBMA), a progressive degenerative disorder of the neuromuscular system caused by the pathologic expansion of a polyglutamine (polyQ) tract in the disordered, N-terminal domain of AR17. In

vitro and in cells, polyQ repeats beyond 37 residues in length cause hormone-dependent AR misfolding and aggregation. In patients and animal models, this misfolding manifests through the

formation of nuclear inclusions in motor neurons and skeletal muscle cells that contain ubiquitinated and misfolded polyQ AR18,19. Importantly, the chaperone-bound form of polyQ AR appears

to be protected from aggregation, such that it only becomes insoluble after androgen-mediated release of the chaperones. Together, these findings in prostate cancer and SBMA have created

particular interest in understanding the molecular mechanisms of how chaperones control the solubility, activation and turnover of AR8,12,20,21. Such discoveries could lead to new

therapeutics: for example, it has recently been shown that chemical activators of Hsp70 regulate the transcriptional activity of AR22,23. AR is a 919-residue protein composed of three

domains: the N-terminal transactivation domain (NTD; residues 1–558), the central DNA-binding domain (DBD; 559-619) and the C-terminal LBD (669–919). The structures of the DBD and LBD bound

to their ligands have been characterized by X-ray crystallography24,25,26,27. The NTD is intrinsically disordered28, but solution nuclear magnetic resonance (NMR) spectroscopy has shown that

it is rich in secondary structure, especially in regions key for transactivation29,30. The NTD of AR is one of the longest in the human SHR family and it includes the polyQ tract, starting

at residue 58, which becomes expanded in SBMA17. Binding of androgens to the LBD causes a large conformational change that leads to the nuclear localization of the receptor, driven by

exposure of a nuclear localization signal between the DBD and the LBD16. Despite its relevance for both transcriptional activity and the onset of SBMA, the nature of this conformational

change is not yet well-established. Nonetheless, it is known that androgen binding exposes a hydrophobic patch in the LBD, termed activation function 2 (AF-2), that has high affinity for a

5-residue FQNLF motif in the N-terminal segment of the NTD31. The inter-domain interaction between this highly conserved motif and AF-2 has been characterized by various biophysical methods,

including X-ray crystallography. These studies show that FQNLF binds to the LBD as an α-helix32, but it is not clear why this conformational transition is also associated with the

disassembly of the chaperone complex. It has been proposed that, similar to GR9, molecular chaperones bind to the LBD of AR and that their affinities for it decrease upon interaction with

DHT, but the mechanisms underlying this regulation are unknown. To investigate the earliest stages of AR activation by androgens, we analyzed the interaction of Hsp70 and Hsp40 with the NTD

of AR in vitro, by solution NMR33, and in cells. Solution NMR is particularly well-suited to the characterization of transient protein–protein interactions (PPIs) involving disordered

domains34. We found that Hsp70 and Hsp40 bind the NTD, with µM affinity and, strikingly, that the binding site contains the same FQNLF motif that interacts with AF-2 in the LBD during

activation. This observation suggests a tug-of-war model in which the FQNLF motif can be bound by either chaperone or the LBD, such that hormone binding shifts partitioning between these two

possibilities. In addition, we found that this part of the NTD has the propensity to form oligomers that are stabilized by interactions involving residues of the FQNLF motif, leading to

aggregation; however its interaction with Hsp70 keeps the protein in solution, explaining why chaperones are so well positioned to block the aggregation and misfolding of AR. Given that

Hsp40, Hsp70, and other chaperones bind near polyQ repeats in other proteins such as huntingtin this suggests a general mechanism35,36 by which these molecular chaperones keep proteins

harboring polyQ tracts soluble. Inspired by these findings, we used small molecules to stabilize the interactions of Hsp70 with AR containing an expanded polyQ tract in cellular and mouse

models of SBMA. Consistent with the results of the biophysical studies, these treatments reduce aggregation and enhance clearance of polyQ-expanded AR. Our results thus provide a structural

basis for how chaperones manage the stability, activation, solubility and turnover of AR, which should inform efforts to treat both prostate cancer and SBMA. RESULTS HSP70 AND HSP40 BIND TO

THE FQNLF MOTIF IN THE AR NTD We used solution NMR to determine whether Hsp40 and Hsp70 bind to the NTD of AR and, if so, where this interaction occurs. This study took advantage of recent

reports that characterized two NTD constructs (NTD1-155 and NTD144-450) in solution26,29. Briefly, NTD1-155 contains the FQNLF motif and the polymorphic polyQ repeat associated with SBMA,

and spans residues 1–155 according to numbering used in the AR entry in the Uniprot database (http://www.uniprot.org/uniprot/P10275); the version of NTD1-155 that we used contains 25

residues in the polyQ repeat, unlike the sequence found in Uniprot, that contains 23 (Fig. 1a). NTD144-450 contains the regions of the NTD involved in interactions with transcription factors

and transcriptional co-regulators, termed activation function 1 (AF-1)29,30. We incubated NTD1-155 (33 µM) or NTD144-450 (33 µM) with either 0.5 or 1 molar equivalents of human Hsp70

(HSPA1A) or Hsp40 (DNAJA2). These experiments were performed in the absence of added nucleotides and samples were held at 5 °C, a temperature that maximizes spectral quality. The 1H,15N-HSQC

spectrum of NTD144-450 was not altered by the addition of either Hsp40 or Hsp70, indicating weak or no interaction (Supplementary Fig. 1). This result is important because NTD144-450

includes hydrophobic motifs that could represent non-specific sites for chaperone binding, yet none were observed to interact under these conditions. By contrast, some signals in the

spectrum of NTD1-155 decreased in intensity (I/I0 ~ 0.3 at [Hsp]/[NTD1-155] = 1) without changing their position in the spectra (Fig. 1b, c). This result indicates that the chaperones

interact selectively with a region within NTD1-155. We found that the states populated under these conditions - the free state and, likely, various bound states37 - are in

intermediate-to-slow exchange on the NMR timescale. The low temperature used to carry out these experiments (5 °C) might contribute to the low observed exchange rate. Also this scenario is

typical for chaperone binding38,39 and suggests a dissociation constant lower than the concentration used in the experiments i.e. in the low micro molar range (see below). In these

experiments, clear decreases in signal intensities were observed in the first 35 residues of NTD1-155, which, strikingly, includes the motif FQNLF; this motif forms a complex with the LBD

after activation by androgens31,32. We observed similar changes for Hsp70 and Hsp40, which is consistent with the known similarity of consensus sites for these two chaperones (see

below)40,41. In addition, we observed much smaller decreases in signal intensity in other residues of NTD1-155 likely caused by transient interactions. For example, intensity changes were

observed in the hydrophobic 55LLLL58 motif that induces a helical structure in the polyQ tract of AR26,27. In summary we found that, prior to activation by androgens,  Hsp70 and Hsp40 bind

to the NTD of AR by selectively interacting with a short region that includes the FQNLF motif. To determine whether this motif is an important part of the region that binds to Hsp40 and

Hsp70, we produced a mutant NTD1-155, named AQNAA-NTD1-155, in which residues Phe 24, Leu 27 and Phe 28 were mutated to Ala. These mutations were predicted to decrease the hydrophobicity of

the putative binding site, expressed as AABUF42 (Supplementary Fig. 2A), a property that is key for the ability of these molecular chaperones to recognize their substrates37,43. By NMR,

neither Hsp40 nor Hsp70 interacted with AQNAA-NTD1-155, confirming that the FQNLF motif is indeed important for the interaction between these molecular chaperones and this region of AR

(Supplementary Fig. 2A). There are two possible regions of Hsp70 where substrates bind to: a canonical site in a hydrophobic groove in the substrate binding domain (SBD) and a non-canonical

interaction surface44. To test which site was used by AR’s NTD1-155 we titrated it into solutions of Hsp70SBD (residues 394 to 509) and measured competition for a model, canonical peptide

(LVEALY-FAM) by fluorescence polarization (FP) in the absence of nucleotides. We found that NTD1-155 competed with LVEALY-FAM (Fig. 2), even better than the NR peptide, a bona fide Hsp70

substrate, suggesting that it bound with an IC50 1.7 ± 0.5 µM to the canonical binding site. We repeated these experiments by using the AQNAA-NTD1-155 mutant and found, in agreement with the

NMR experiments, that it had ~10-fold weaker affinity for Hsp70 (Supplementary Fig. 3). To further verify this interaction by an independent method, we measured the affinity between

NTD1-155 and Hsp70 by isothermal titration calorimetry (ITC). Although it was challenging to quantify the affinity because of solubility limitations, the binding affinity was estimated to be

~5 µM (Fig. 2b). This value is in good agreement with the FP studies as well as with the NMR titrations because this dissociation constant should lead, in the slow exchange regime, to I/I0 

~ 0.3 when the NTD1-155 (at 33 µM) is in the presence of an equimolar amount of molecular chaperone (see Fig. 1b). Together, these results suggest that the region of sequence corresponding

to the FQNLF motif of AR and its flanking regions represents a canonical substrate for Hsp70. As mentioned above, Hsp40 and Hsp70 often compete for the same sites on their client proteins.

To understand the relative affinities of these chaperones, we measured binding of purified, human Hsp40 (DnaJA2) for NTD1-155 by ITC. Hsp40 bound slightly tighter to NTD1-155, with a Kd of

3.3 ± 2.3 µM (Supplementary Fig. 3B). The stoichiometry of the complex was estimated to be ~2 Hsp40s per NTD1-155, (_n_ = 0.49 ± 0.27) consistent with the dimeric structure of this

chaperone. These results suggest that both Hsp70 and Hsp40 bind with low micromolar affinity to NTD1-155. HSP70 AND HSP40 BIND TO THE FQNLF MOTIF IN CELLS To validate in cells the

observations made in vitro HEK293T cells were transfected with full length AR tagged with the FLAG epitope (FLAG-AR) and its interaction with endogenous Hsp40 and Hsp70 was assessed by

proximity ligation assay (PLA). This immunofluorescence-based technique is particularly useful for detecting transient PPIs in cells where the putative complexes are of intermediate or low

stability and therefore unlikely to withstand the washing steps that are required for co-immunoprecipitation experiments45. Briefly, the method relies on the use of primary antibodies that

recognize the two proteins (e.g. AR and Hsp70), and on secondary antibodies that are conjugated to complementary oligonucleotides. When the proteins are in close proximity, these

oligonucleotides hybridize and are ligated to form a circular DNA template that can be amplified by DNA polymerase and detected by fluorescence probes. The PLA signals can therefore be

detected by fluorescence microscopy as red puncta in the PLA experiment. Using this approach, we observed a clear interaction between FLAG-AR and both Hsp40 and Hsp70 in the cytoplasm prior

to activation but found that DHT treatment induced an almost complete loss of the interaction (Fig. 3a, c) combined with nuclear translocation (Supplementary Fig. 4). These results agree

with the notion that activation of AR by DHT causes the dissociation of the cytosolic complexes that AR forms with molecular chaperones prior to nuclear translocation3,8. To test whether the

interaction detected by PLA occurs in cells via the region of sequence containing the FQNLF motif detected by NMR, we repeated these experiments using a version of FLAG-AR with the FQNLF

motif mutated to AQNAA (FLAG-AR-mut) and a deletion mutant, where the region of sequence spanning residues 21 to 35, which includes the FQNLF as well as adjacent similar VREVI motif, was

deleted (FLAG-AR-del). We observed that while FLAG-AR-mut could still interact with both Hsp40 and Hsp70 (Supplementary Fig. 5), the interaction of FLAG-AR-del with both molecular chaperones

was substantially weaker (Fig. 3a, c). These results suggest that mutation of the three residues at the core of the FQNLF motif is not sufficient to abolish the affinity for Hsp70 or Hsp40,

that instead requires the complete deletion of this motif and the ca. 10 residues immediately flanking it. This result is consistent with the 10-fold weakened affinity of the AQNAA mutant

for Hsp70 observed in the NMR and FP experiments (see Supplementary Fig. 3). It should be noted that our PLA experiments were designed to detect the interaction of molecular chaperones with

the NTD of AR and are therefore unlikely to report on whether they interact with the LBD. In addition, the fact that both FLAG-AR-mut and FLAG-AR-del readily translocate to the nucleus upon

activation suggests that these variants retain some early AR functions (Supplementary Fig. 4). Collectively, these results confirm that, in cells, prior to activation by androgens, the

molecular chaperones Hsp40 and Hsp70 bind to AR via a region of sequence including the motif FQNLF and the residues flanking it. Hsp70 and Hsp40 have both been implicated in turnover of AR.

To probe the role of their interaction with the FQNLF motif in this process, we compared the levels of FLAG-AR-mut and FLAG-AR-del with those of the wild type protein prior and following to

activation with DHT. We observed that mutation and, especially, deletion of the FQNLF motif caused an increase in basal AR levels in the absence of hormone (Fig. 3b, Supplementary Fig 5B).

Also, recent studies have shown that disrupting AR’s N/C interaction delays disease onset in a mouse model of SBMA46. These studies utilized mice that expressed a mutant form of the polyQ AR

where the Phe residue of the FQNLF motif was mutated to Ala. To determine whether this mutation had an effect on the interaction between the AR NTD and molecular chaperones, we carried out

experiments with the equivalent mutant of NTD1-155, named AQNLF-NTD1-155. An analysis of the interaction by NMR showed that the AQNLF mutant interacts in vitro with molecular chaperones with

an affinity that was indistinguishable from that of the WT (Supplementary Fig. 6). Thus, our results confirm that amelioration of the SBMA phenotype in mice expressing this mutant is likely

due to a weakening of the N/C interaction rather than an altered interaction with molecular chaperones. HSP70 INCREASES THE SOLUBILITY OF THE AR NTD Because Hsp70 and Hsp40 are released

from the NTD1-155 after addition of the androgen dihydrotestosterone (DHT), the hormone-dependent phenotype of SBMA and ligand-dependent aggregation of the polyQ AR strongly suggest a

protective role for these molecular chaperones in limiting AR aggregation47,48,49,50. To investigate this possibility by solution NMR, we analyzed the oligomerization properties of the

NTD1-155 construct by measuring 1H,15N-HSQC spectra at two different concentrations, 125 and 450 μM at 278 K. NMR can be used to monitor concentration-dependent oligomerization because the

monomer-to-oligomer exchange process contributes to NMR linewidths, such that the _R_2 15N relaxation rates are increased51. In NTD1-155 we first confirmed that the position of the backbone

amide chemical shifts did not change with concentration. Then, we measured the _R_2 15N relaxation rates and found that some residues had higher values at 450 μM, when compared to 125 μM

(Fig. 4a). A closer examination of these linewidth changes showed that the affected residues were clustered into regions of locally high AABUF values, suggesting that hydrophobicity could be

the main driving force of oligomerization. Indeed, the most affected region was localized to the first 50 residues of the construct, with a maximum in the FQNLF motif. This observation is

conceptually equivalent to that made by Wetzel and co-workers in huntingtin, in which it was shown that the early stages of aggregation are not driven by inter-molecular interactions

involving the polyQ tract, but rather by hydrophobic, coiled coil-like interactions in the sequence flanking it at the N-terminus52,53. Further, these results raise the intriguing

possibility that binding of molecular chaperones to this region of AR might directly suppress its oligomerization. We then carried out NMR experiments to directly study whether the

interaction of Hsp70 with the NTD1-155 construct influenced its solubility. For these experiments, we prepared samples of NTD1-155 at 125 μM and added human Hsp70 at 1 molar equivalent,

using the same conditions presented in Fig. 1, and measured the corresponding 1H,15N-HSQC spectra as a function of incubation time at 298 K. In the absence of chaperone, we observed a

progressive decay of signal intensity, so that after 6 days of incubation, ~25 % of the signal intensity was lost. This signal decay was likely caused by formation of aggregates whose size

precluded their detection by NMR, as evident by the turbidity of the samples over time. By contrast, the samples containing Hsp70 did not show any decrease of signal intensity, suggesting

that the complex remained soluble (Fig. 4b). These results suggest that molecular chaperones limit self-interactions between FQNLF motifs in different AR NTD molecules, diminishing its

oligomerization and maintaining solubility. HSP70 INCREASES AR SOLUBILITY IN VIVO A key prediction of these studies is that chemical stabilization of the Hsp70 interaction might limit

aggregation of polyQ AR. Recent work has produced chemical probes that significantly enhance Hsp70’s affinity for disordered proteins54. Briefly, Hsp70 normally cycles through rounds of ATP

hydrolysis, with the ATP-bound state having relatively poor affinity for substrate proteins and the ADP-bound state having tight affinity55. These compounds, such as YM-1, favor the

ADP-bound state56, therefore stabilizing Hsp70’s interactions. In addition, stabilizing this complex has been shown to enhance turnover of some Hsp70 client proteins54. Thus, we hypothesized

that these compounds might limit polyQ AR aggregation and potentially promote its turnover in SBMA models. To understand if Hsp70 modulators might have these favorable activities, we first

tested a small panel of them in PC12 cells that stably express AR with an expanded polyQ tract encoded by 112 CAG repeats, termed AR112Q, under a tetracycline responsive promoter57. In these

cells, treatment with ligands, such as DHT or the synthetic androgen metribolone (R1881), leads to nuclear accumulation of misfolded polyQ AR, consistent with aggregation after release of

chaperones. SDS-insoluble polyQ-AR species can be separated by centrifugation and visualized by western blot or by filter trap assay (Supplementary Fig. 7). In our small-scale screen, we

found that two Hsp70 modulators, JG-84 and JG-98, were the most potent in enhancing solubility of polyQ AR (Supplementary Fig. 7A-D). Moreover, the active molecules promoted clearance of

both monomeric and aggregated polyQ AR species (Supplementary Figs. 7D–F, 8), and were more striking on polyQ AR than wild type AR (Supplementary Fig. 8). Further analysis demonstrated that

the more potent Hsp70 modulator, JG-98, increased polyQ AR ubiquitination and enhanced degradation through the proteasome (Fig. 5a, b). Notably, treatment with JG-258, a structural analog of

JG-98 that does not bind Hsp7058, does not change steady state polyQ AR levels or alter polyQ AR ubiquitination (Supplementary Fig. 9). We wondered whether these effects might occur because

of an HSF1 dependent stress response. To test this idea, we performed western blots for three stress-inducible biomarkers: Hsp25, Hsp40, and Hsp70. In treated cells, reduction of AR112Q

occurred without induction of heat shock proteins (Fig. 5c). In contrast, the Hsp90 inhibitor, 17-AAG, strongly increased the levels of these proteins (Fig. 5c), consistent with induction of

an HSF1 dependent stress response. Additionally, JG-98 did not affect levels of Hsp90 client proteins in their native conformations, such as Akt and Erk (Fig. 5c), both of which are

degraded following treatment with Hsp90 inhibitors. Finally, recent work has suggested that combining Hsp70 modulators with Hsp90 inhibitors might further promote AR clearance12. Consistent

with this notion, we found that combinations of an Hsp70 modulator, JG-98, with an Hsp90 inhibitor, 17-AAG, produced robust polyQ AR clearance (Fig. 5d). Together, these findings supported a

model in which stabilizing the Hsp70-AR interaction enhances the solubility and clearance of AR. To test this idea in an animal model of SBMA, we turned to an analog of the Hsp70

modulators, JG-294, that is tolerated in mice and has well-studied pharmacokinetics58. Before proceeding into animals, we first confirmed that JG-294 could induce degradation of polyQ AR in

PC12 cells expressing AR112Q. Indeed, treatment with JG-294 yielded a significant reduction in the levels of AR112Q, as detected by western blot and immunofluorescence microscopy (Fig. 6b,

c). Next, we tested whether JG-294 might have activity in a well-characterized mouse model of SBMA generated by gene targeting (AR113Q mice)50,59. In this model, like the cell-based system,

AR113Q accumulates as SDS-insoluble high molecular weight species in skeletal muscle from mutant males. Strikingly, treatment with JG-294 for two weeks (i.p., at 3 mg kg−1 every other day)

reduced levels of both high molecular weight and monomeric polyQ AR when compared to the vehicle treated controls (Fig. 7a, b, d, e). These changes occurred without alteration in AR mRNA

levels (Fig. 7c), consistent with the notion that JG-294 promoted polyQ-AR clearance. Notably, as in cell culture, these effects were distinct from those triggered by treatment with an Hsp90

inhibitor, as no induction of Hsp70 or loss of client proteins in their native conformation were seen following treatment with JG-294 (Fig. 7e). Together, these results suggest that

stabilizing the interactions between Hsp70 and AR may be a viable therapeutic strategy for SBMA. Collectively, our findings support a model in which Hsp70 directly binds to the NTD of AR as

a sensor for misfolding and aggregation. DISCUSSION We show here that AR activation seems to be governed, in part, by a competition between chaperones and the AF-2 region for binding to a

region of the NTD including the FQNLF motif. Specifically, inter-molecular interactions with Hsp70 and Hsp40 appear to prevent activation of AR by sequestering the FQNLF motif while

intra-molecular interactions of this same region with AF-2 in the LBD are required for activation. We find that the relative strength of these competing PPIs is regulated by androgen binding

to the LBD, which stabilizes the AF-2, and, therefore, promotes its interaction with the FQNLF motif and displaces the chaperones. What is the role of the Hsp40 in this process? Hsp40 and

Hsp70 normally work in concert and, by analogy with other systems, we propose that Hsp40 binds AR first and then recruits Hsp70 via its conserved J-domain. In cells, binding of the J-domain

stimulates ATP cycling by Hsp7060, which creates the tight affinity, client-chaperone complex. Therefore, we expect that Hsp40 would assist Hsp70 by both localizing it to AR and accelerating

its catalytic cycle. This is important because our in vitro experimental platforms, while aimed at investigating the equilibrium properties of the system in the absence of nucleotide,

likely underestimate the effective affinity for the NTD. Moreover, there are more than 45 proteins in the Hsp40 family in humans, so the relevant subset for AR homeostasis is not yet clear.

One of the interesting implications of this model is that the structure of the FQNLF motif itself might switch when bound to either the chaperones or AF-2. Specifically, it is known that the

FQNLF motif is helical after binding to AF-2 and activation, yet we have shown that it can interact with the canonical groove of Hsp70, likely in an extended conformation. Thus, these

studies suggest that (at least) two sets of competing PPIs, in addition to a local conformational switch, underlie the activation of AR. Further experiments will be needed to understand

whether there is a link between these molecular events and the broader changes that occur during nuclear translocation and transcriptional activity of AR. Additionally, it has previously

been observed that Hsp70 binds to the LBD of SHRs9 and it is not yet known whether the N-terminal mechanism presented here is connected to other chaperone-mediated processes at the LBD.

Despite these remaining questions, this molecular view of AR dynamics and PPIs has a number of interesting implications. First, these results also provide insight into how Hsp70 and Hsp40

regulate the solubility of AR. We noted that Hsp70 prevents the oligomerization of AR’s NTD1-155 (Fig. 4), likely by directly encumbering the FNQLF motif and surrounding regions that are

hydrophobic and aggregation-prone. We speculate that this activity, combined with the fast turnover of AR prior to androgen binding, conspire to minimize the propensity of the receptor to

oligomerize and aggregate by preventing exposure of the most aggregation-prone sequence while simultaneously keeping its concentration low in the cytoplasm. In this scenario, molecular

chaperones would contribute, by acting as holdases, to keeping the receptor monomeric and at low concentration i.e. primed for rapid activation by androgens without compromising solubility.

Putting these mechanisms together, it seems elegant to propose that Hsp70’s interactions with the FQNLF motif might create a three-way tug-of-war, in which the chaperone competes for both:

(a) proper intra-molecular contacts with AF-2 and (b) inter-molecular contacts between the FQNLF motifs of two AR molecules, leading to aggregation. The relative affinities of these

competing PPIs likely balances the activation of the receptor and governs its unnatural aggregation in SBMA (Fig. 8). Based on the experiments with Hsp70 modulators, we propose that this

delicate balance of PPIs also regulates AR turnover. In other systems, such as microtubule-associated protein tau (MAPT) and X-linked inhibitor of apoptosis (XIAP), tight binding of Hsp70

has been observed to promote turnover54,61. Similarly, prolonged interactions with Hsp70 seem to favor turnover of polyQ-expanded AR. Thus, more broadly, Hsp70 seems to use a dwell time

method to discriminate between damaged and healthy proteins (Fig. 8). In the case of AR, the incorrect decision to release polyQ AR may partially underlie protein aggregation in SBMA, such

that chemical perturbations with JG-98 or JG-294, can partially re-balance the system and promote turnover. In this model, it is striking that the same chaperone that governs receptor

activation and solubility is also tasked with monitoring its quality control. Notably, numerous functions essential for cell viability, ranging from energy and ion homeostasis to axonal

transport and gene expression, are disrupted by misfolded proteins that cause age-dependent protein aggregation neurodegenerative disorders, including SBMA62,63. Alterations in these

multiple pathways likely contribute to toxicity in a cumulative manner, suggesting that therapeutically targeting any one of them is likely to yield incomplete rescue. In contrast,

decreasing levels of mutant proteins such as the polyQ AR has emerged as an attractive therapeutic strategy to target the proximal mediator of disease pathogenesis. In this regard, our

findings have implications for potential new therapies. Many efforts to develop chaperone-targeted therapies for protein aggregation diseases have focused on inhibition of Hsp90. Our data

indicate that targeting Hsp70 may have significant advantages. For example, Hsp70 activation favors the removal of misfolded proteins rather than client proteins in their native or

near-native states11,12,64. This distinction suggests that Hsp70-targeted small molecules may avoid some of the toxic effects of Hsp90 inhibitors, which promote degradation of hundreds of

client proteins in their native conformations, some of which might be needed for normal cellular functions. Similarly, the other major strategy for activating chaperone function is to target

the stress response transcription factor, HSF1. However, experimental evidence suggests that chronic activation of HSF1 may promote toxicity by triggering a maladaptive stress response that

is present in many protein-folding diseases65. In contrast, we found that targeting Hsp70 does not lead to activation of stress-responsive proteins. Thus, these results suggest that Hsp70

may be a good target for the treatment of SBMA. In addition, AR has been implicated in other diseases, such as prostate cancer. Indeed, recent studies have established that the same

Hsp70-targeted small molecules promote clearance of an AR splice variant that is associated with prostate cancer and lacks the C-terminal LBD13. Together, these observations point to Hsp70

as a promising target in multiple AR-associated diseases. Such strategies may take advantage of the normal protein quality control functions of this chaperone, which are already evolved to

regulate AR solubility and degrade the damaged receptor. METHODS PROTEIN EXPRESSION AND PURIFICATION The genes codifying for NTD1-155 and its variants were purchased from GeneArt and cloned

in a pDEST-HisMBP vector (Addgene: #11085) whereas that codifying for NTD144-45029 was instead cloned into a Gateway pDEST17 vector (Invitrogen). Expression of the resulting genes led to

fusion proteins containing a His6 tag, a maltose binding protein (MBP) moiety for NTD1-155 and its variants and a motif recognized by the tobacco etch virus (TEV) protease. The His6 tag was

used as a purification tag, whereas MBP was used to increase the solubility of NTD1-155 and its variants. 15N labeled protein expression was carried out in Rosetta (DE3) pLysS E. coli

competent cells Novagen (Merck), grown in Luria Broth (LB; Melford) at 37 °C at 220 r.p.m. until the value of OD600 was 0.7, centrifuged at 2000 G for 20 min, then washed in MOPS buffer

(3-(N-morpholino) propanesulfonic acid (200 mM), sodium acetate (50 mM), EDTA (10 mM), pH 7.0) devoid of nitrogen sources and rapidly centrifuged at 5000 G for 10 minutes. Cells were then

resuspended in MOPS media containing 15NH4Cl as a nitrogen source (Eurisotope), induced with 0.5 mM Isopropyl β-d-1-thiogalactopyranoside (IPTG, Sigma) for 4 hours at 28 °C, harvested by

centrifugation and resuspended in core buffer (50 mM sodium phosphate, 500 mM NaCl, 5% (v/v) Glycerol, 1 mM 2-Mercapto-ethanol, pH 8.0). A HisTrap HP 5 ml column (GE Healthcare) was used to

purify the proteins, which were eluted by an imidazole gradient (final composition: 500 mM imidazole, 50 mM sodium phosphate, 500 mM NaCl, 5% Glycerol, 1 mM βMercapto-ethanol, pH 8.0),

followed by a size exclusion step carried out in a Superdex HighLoad S200 26/60 column (GE Healthcare) equilibrated in a buffer with the following composition: 500 mM NaCl, 12 mM sodium

phosphate, 5% glycerol, 1 mM DTT, pH 7.5. To separate NTD1-155 from its tags, the pure fusion proteins were then incubated with His6-tagged TEV protease for 16 hours at 4 °C by dialysis

against a buffer containing 20 mM sodium phosphate, 100 mM NaCl, and 0.5 mM EDTA, pH 8.0. The product of proteolytic cleavage was separated from the tags by Ni2+ affinity chromatography,

employing a buffer containing 8 M urea (500 mM imidazole, 50 mM sodium phosphate, 100 mM NaCl, 8 M urea, pH 8.0) to prevent the aggregation of the cleaved AR in the column. Finally, the

cleaved proteins were stored at −80 °C. Full length, human Hsp70 (HSPA1A) and Hsp40 (DnaJA2) constructs were transformed into BL21(DE3) cells and single colonies were used to inoculate

Terrific Broth (TB) medium containing ampicillin (50 µg mL−1). Cultures were grown at 37 °C for 5 h, cooled to 20 °C and induced overnight with 200 μM IPTG. DnaJA2 and Hsp70 (SBD) (residues

394–540) were purified using a Ni2+-NTA column, followed by overnight TEV cleavage of the His tag and gel filtration on a Superdex S200 (GE Healthcare). Hsp70 was purified using a Ni2+-NTA

column, followed by overnight TEV cleavage and subjection to an ATP agarose column. Hsp70 was eluted with ATP and dialyzed to remove excess nucleotide. This purification method provides

Hsp70 in its ADP-bound state, based on partial proteolysis. A truncated form of Hsp70SBD (HSPA1A) was used for the FP studies, which encompasses residues 394-509, was purified in a similar

way. NMR SAMPLE PREPARATION The protein solutions stored at −80 °C were thawed and dialyzed for 16 h at 4 °C against a phosphate buffer (sodium phosphate (20 mM),

tris(2-carboxyethyl)phosphine (TCEP, 1 mM), pH 7.4). Finally, 10% D2O and 0.015 mM DSS were added to the samples. ACQUISITION AND ANALYSIS OF NMR SPECTRA Two-dimensional 1H,15N-HSQC NMR

experiments were recorded at 5 °C on a Bruker 600 or 800 MHz spectrometer equipped with cryogenic probes. Spectra were processed with NMRPipe66 and analyzed using CcpNMR Analysis67. The NMR

samples used for the experiments reported in Fig. 1, Supplementary Figs. 1 and 5 contained 33 µM 15N single-labelled NTD1-155 protein and either 16.5 µM or 33 μM unlabeled Hsp70 and Hsp40 in

20 mM phosphate buffer, pH 7.4, 1 mM TCEP, and 10% (v/v) D2O. The NMR samples used for the experiments shown in Supplementary Fig. 1 were equivalent to those used for the experiments shown

in Fig. 1, but contained NTD144-450 instead of NTD1-155. The NMR samples used for the experiments reported in Fig. 4a contained 125 and 450 µM 15N single-labelled NTD1-155 constructs and

those used for the experiments reported in Fig. 4b contained 125 µM 15N single-labelled NTD1-155 constructs and 125 μM unlabeled Hsp70. The 15N _R_2 rates of NTD1-155 were measured with 10

different relaxation delays (t) and fit to the equation \(I = I_o{\mathrm{exp}}( - R_2t)\) and only the values of _R_2 determined with less than 5% error were considered sufficiently

reliable for the analysis shown in Fig. 4a. The ratio of signal intensities shown in Fig. 4b corresponds to the total signal intensity of the signals that are not affected by chaperone

binding (Fig. 1) measured at a given time divided by that measured after 1 day of equilibration. FLUORESCENCE POLARIZATION ASSAYS For competition FP studies, 2 μM Hsp70SBD and 25 nM

FAM-LVEALY (Anaspec) were incubated with varying concentrations of AR protein for 30 min at room temperature in assay buffer (100 mM Tris, 20 mM KCl, 6 mM MgCl2 pH 7.4). After incubation,

fluorescence polarization was measured (excitation: 485 nm emission: 535 nm) using a SpectraMax M5 plate reader. In the case of the FAM-NRLLLTG tracers, 12 μM Hsp70SDB, and 25 nM tracer were

used and experiment was performed in a similar manner. These experiments were repeated in duplicate and repeated on three independent days. ISOTHERMAL TITRATION CALORIMETRY The NTD1-155

proteins, as well as Hsp70SBD or Hsp40, were dialyzed overnight against ITC buffer (25 mM HEPES, 5 mM MgCl2, 10 mM KCl pH 7.5). Concentrations were determined using a BCA Assay (Thermo

Fisher Scientific), and the experiment was performed with a MicroCal ITC200 (GE Healthcare) at 25 °C. AR protein (100–200 μM) in the syringe was titrated into a 10–20 μM cell solution of

Hsp70 (SBD) protein. Calorimetric parameters were calculated using Origin 7.0 software and fit with a one or two-site binding model. Experiments were performed in duplicate and repeated

twice on two independent days. CELL CULTURE AND TRANSFECTION Human embryonic kidney 293 T cells (HEK293T cells) were obtained from ATCC (CRL-3216) and maintained in DMEM containing 4.5 g L−1

glucose (Glutamax, Gibco) supplemented with 10% (v/v) charcoal stripped calf serum (Gibco) and antibiotics. Cells were cultured in a humidified atmosphere containing 5% CO2 at 37 °C.

Transient transfection of HEK293T cells was performed with polyethylenimine (PEI) (Polysciences) at a ratio of 1 µg DNA to 3 µl PEI to express androgen receptor tagged with the FLAG epitope

(FLAG-AR), the mutated version (FLAG-mut) and the version lacking the region of sequence targeted by Hsp40 and Hsp70 in the NMR experiments (FLAG-del). PC12 cells expressing

tetracycline-inducible AR112Q (gift of Diane Merry, Thomas Jefferson University) were characterized previously57. Cells were maintained in phenol red-free DMEM (21063-029, Invitrogen)

supplemented with 5% charcoal stripped fetal calf serum (Thermo Scientific Hyclone Products), 10% charcoal stripped horse serum (Invitrogen), G418 (Gibco) and Hygromycin B (Invitrogen). When

indicated, cells were transfected using Lipofectamine 2000 (Life Technologies) or the Neon transfection system (Thermo Scientific) to express human CHIP and HA-His-ubiquitin (gifts from Dr.

Yoichi Osawa, Univ. of Michigan). AR expression was induced with 0.5 µg mL−1 doxycycline (Clonetech) and activated by treatment with the synthetic androgen R1881. Lactacystin was from

Sigma-Aldrich (L6785) and 17-AAG was from LC Laboratories (A-6880). ANTIBODIES AND REAGENTS For Western Blot analyses the following antibodies were used: anti-β-actin-HRP (ab8224, 1:10000)

(Abcam), rabbit-anti-FLAG (F7425, 1:2000), and mouse-anti-FLAG M2 (F1804, 1:2000) (Sigma), mouse-anti-HSP70/72 (ADI-SPA-810) and rabbit-anti-HSP40 (ADI-SPA-400-D) (Enzo Life Science).

Additional primary antibodies were used against Akt (C6E7; Cell Signaling Technology), ERK1/2 (9102, Signaling Technology), GAPDH (NB-600-502; Novus Biologicals), HSP90 (H114, sc7947; Santa

Cruz Biotechnology), CHIP (PA5-32046, Thermo Scientific, Pierce), HA (MMS-101R, Covance, Biolegend), HSP25 (ADI-SPA-801-488; Enzo Life Science), and HSP70 (ADI-SPA-812; Enzo Life Science).

HRP conjugated secondary antibodies were from Bio-Rad (170-6515, 170-6516). For immunofluorescence the following primary antibodies were used: rabbit-anti-FLAG (F7425, 1:200),

mouse-anti-FLAG M2 (F1804, 1:200) (Sigma), AlexaFluor conjugated secondary antibodies were from Life Technologies (A11072, 1:300). Mounting medium with DAPI (H-1200, 1:500) was from Vector

Labs. For immunoprecipitation, pull down was performed with protein A–agarose beads (Santa Cruz Biotechnology) and the anti-AR antibody (PG21; Millipore). WESTERN BLOTTING Cells were washed

and harvested in PBS, lysed in RIPA buffer (Technova) containing phosphatase and protease inhibitors (Roche). Lysates were centrifuged at 15000 g to separate soluble and pellet fractions.

Total protein was quantified using BCA assay (Pierce Biotechnology). Proteins were resolved by 7.5 or 15% SDS-PAGE, transferred to PVDF or nitrocellulose membranes, and probed with specific

antibodies. Filter retardation assay was performed by sample filtration through a 0.2 μm cellulose acetate membrane (Whatman, GE Healthcare) using a slot-blot apparatus. For ubiquitination

studies, cells were homogenized in buffer (0.025 M Tris, 0.15 M NaCl, 0.001 M EDTA, 1% NP-40, 5% glycerol, pH 7.4) containing protease inhibitors and 5 mM N-ethylmaleimide (Sigma-Aldrich).

Lysates were incubated on a rotator at 4 °C for 2 h with AR antibody or non-immune rabbit IgG (Santa Cruz Biotechnology). Prewashed protein A–agarose beads were added, and samples were

incubated for 1 additional hour at 4 °C. Protein-antibody-bead complexes were washed 6 times in buffer, and proteins were eluted by boiling in SDS-loading buffer for 5 min at 100 °C. Samples

were then resolved on by 7.5% SDS-PAGE. Images of uncropped and unprocessed scans of blots are provided as Source Data files. Agarose gel electrophoresis for resolving aggregates was

performed as previously described68. Briefly 150 µg total protein was loaded to 1.5% agarose gels (375 mM Tris buffer, pH 8.6; 0.1% SDS) and electrophoresed at 100 V until the dye front had

reached the bottom of the gel. Transfer of proteins was performed using a semi-dry transfer apparatus to PVDF membranes. IMMUNOFLUORESCENCE For immunofluorescence, cells were seeded on

sterilized 12 mm microscope coverslips, fixed 15 min in 4% paraformaldehyde at room temperature and permeabilized in ice-cold methanol for 10 min. Cells were then washed, blocked with PBS

containing 2% bovine serum albumin for one hour at room temperature and incubated with the corresponding primary antibody diluted in blocking solution for one hour. After washing with PBS,

samples were further incubated with the corresponding secondary antibodies for one hour. DAPI was used to label DNA and the coverslips were washed, air-dried and mounted on slides using

Prolong Gold antifade mountant (Life technologies). 6 μm cryosections of muscle were fixed in methanol. Slides were stained, mounted, and imaged by confocal microscopy (Olympus FV 500 or

Nikon A1). Nuclear signal intensity was quantified by CellProfiler. PROXIMITY LIGATION ASSAY The Duolink in situ Proximity ligation (PLA) kit (Olink Bioscience) was used for  the detection

of protein–protein interactions according to the manufacturer’s instructions45. The assay is based on the simultaneous binding of two antibodies to the proteins of interest and makes use of

a proximity ligation technique combined with an amplification reaction to detect the antibodies whenever they are less than 30 nm apart. HEK293T cells were grown and transfected as indicated

on 12 mm microscope coverslips (Thermo). Cells were fixed in PBS containing 4% paraformaldehyde for 15 min and permeabilized with methanol for 5 min. Fixed cells were blocked in PBS

containing 2% BSA (Sigma) for an hour and then incubated with the indicated antibodies against Hsp70 (ADI-SPA-810, 1:100), Hsp40 (ADI-SPA-400-D, 1:100) (Enzo Life Science) and FLAG (M2,

F1804 and F7425, both 1:50) (Sigma). Samples were subsequently incubated for 1 h at 37 °C with secondary antibody PLA with and without probes for mouse and rabbit (Sigma), and then for 30 

min at 37 °C with a ligation solution to ligate the two PLA probes and form a circular DNA template. A rolling-circle amplification was then performed by incubating the cells for 100 min at

37 °C with the amplification solution. The amplicons generated are recognized by fluorescent oligonucleotides present in the amplification solution. Nuclei were stained with DAPI and the

coverslips were washed, air-dried and mounted on slides using Prolong antifade mountant (Life Technologies). Cells were analyzed with a ×63 objective on a Leica SP5 confocal microscope.

Images were presented as maximal projection of z-stacks by using Fiji. AR113Q MICE AR113Q knock-in mice were generated using exon 1-specific gene targeting50,59, backcrossed to C56BL/6 (≥10

generations), and housed in a specific pathogen-free facility on a 12-h light/dark cycle with chow and water ad libitum. For analysis, AR113Q males were used at 3 months of age and randomly

assigned to treatment groups. JG-294 was dissolved in 70% propylene glycol (W294004, Sigma-Aldrich) and 30% PBS (pH 7.4, Life Technologies), heated to 95 °C to dissolve compound, aliquoted

and frozen. Mice received intraperitoneal injections (3 mg kg−1) every other day for 2 weeks. 17-DMAG (S1142, Selleckchem) was dissolved in 1% DMSO (D2650, Sigma-Aldrich), 30% polyethylene

glycol (202371; Sigma-Aldrich) and 1% Tween80 (P4780; Sigma-Aldrich), and administered by i.p. injection (10 mg kg−1) every other day for 2 weeks. At the end of treatment, mice were

euthanized and quadriceps were harvested and flash frozen in liquid nitrogen or mounted on OCT (Tissue-Plus, Fisher Health Care) for cryosectioning. For western blot, lysates were obtained

by homogenizing tissue in RIPA containing phosphatase and protease inhibitors. All procedures involving mice were approved by the University of Michigan Committee on Use and Care of Animals

(PRO00008133) and conducted in accordance with institutional and federal ethical guidelines for animal testing and research. QUANTITATIVE RT-PCR Total RNA was extracted from mouse quadriceps

muscles using Trizol (Sigma-Aldrich). cDNA was synthesized from extracted RNA using the High Capacity cDNA Reverse Transcription Kit (Applied Bio Systems). Quantitative PCR was carried out

on a 7500 Real-Time PCR System (Applied Biosystems) using FastStart TaqMan Probe Master Mix (Roche) and gene specific primers for AR (universal probe library #58, Roche; 5′ primer:

ccagtcccaattgtgtcaaa; 3′ primer: tccctggtactgtccaaacg) and Cpsf2 (Mm00489754_m1, Applied Biosystems). Relative AR expression was determined by the standard curve method and normalized to

Cpsf2. STATISTICS Statistical significance was determined by analyzing data sets using unpaired Student’s _t-_test, one-way ANOVA with Tukey’s multiple comparison test or two-way ANOVA with

Bonferroni or Niewman–Keuls multiple comparison test in Prism6 (GraphPad). Differences between mean values were defined as significant at _p_ < 0.05. REPORTING SUMMARY Further information

on research design is available in the Nature Research Reporting Summary linked to this article. DATA AVAILABILITY The source data underlying the quantifications shown in Figs. 2A, 3B, 4B,

5A, 5D, 6B, 6C, 7B, 7C, 7E, and Supplementary Figs. 3A, 7F, and 9A are available as Source Data files and any other data is available from the corresponding authors upon reasonable request.

CHANGE HISTORY * _ 07 OCTOBER 2019 An amendment to this paper has been published and can be accessed via a link at the top of the paper. _ REFERENCES * Saibil, H. Chaperone machines for

protein folding, unfolding and disaggregation. _Nat. Rev. Mol. Cell Biol._ 14, 630–642 (2013). Article  CAS  Google Scholar  * Kim, Y. E., Hipp, M. S., Bracher, A., Hayer-Hartl, M. &

Ulrich Hartl, F. Molecular chaperone functions in protein folding and proteostasis. _Annu. Rev. Biochem._ 82, 323–355 (2013). Article  CAS  Google Scholar  * Pratt, W. B. & Toft, D. O.

Steroid receptor interactions with heat shock protein and immunophilin chaperones. _Endocr. Rev._ 18, 306–360 (1997). CAS  PubMed  Google Scholar  * Pratt, W. B. & Toft, D. O. Regulation

of signaling protein function and trafficking by the hsp90/hsp70-based chaperone machinery. _Exp. Biol. Med._ 228, 111–133 (2003). Article  CAS  Google Scholar  * Bohen, S. P., Kralli, A.

& Yamamoto, K. R. Hold’em and fold’em: chaperones and signal transduction. _Science_ 268, 1303 (1995). Article  CAS  ADS  Google Scholar  * Cato, L. et al. Development of Bag-1L as a

therapeutic target in androgen receptor-dependent prostate cancer. _eLife_ 6, e27159 (2017). * He, B. et al. An androgen receptor NH2-terminal conserved motif interacts with the COOH

terminus of the Hsp70-interacting protein (CHIP). _J. Biol. Chem._ 279, 30643–30653 (2004). Article  CAS  Google Scholar  * Cano, L. Q., Lavery, D. N. & Bevan, C. L. Mini-review:

foldosome regulation of androgen receptor action in prostate cancer. _Mol. Cell. Endocrinol._ 369, 52–62 (2013). Article  Google Scholar  * Kirschke, E., Goswami, D., Southworth, D.,

Griffin, P. R. & Agard, D. A. Glucocorticoid receptor function regulated by coordinated action of the Hsp90 and Hsp70 chaperone cycles. _Cell_ 157, 1685–1697 (2014). Article  CAS  Google

Scholar  * Sahasrabudhe, P., Rohrberg, J., Biebl, M. M., Rutz, D. A. & Buchner, J. The plasticity of the Hsp90 co-chaperone system. _Mol. Cell_ 67, 947–961.e5 (2017). Article  CAS 

Google Scholar  * Pratt, W. B., Gestwicki, J. E., Osawa, Y. & Lieberman, A. P. Targeting Hsp90/Hsp70-based protein quality control for treatment of adult onset neurodegenerative

diseases. _Annu. Rev. Pharmacol. Toxicol._ 55, 353–371 (2015). Article  CAS  Google Scholar  * Wang, A. M. et al. Activation of Hsp70 reduces neurotoxicity by promoting polyglutamine protein

degradation. _Nat. Chem. Biol._ 9, 112–118 (2013). Article  CAS  Google Scholar  * Moses, M. A. et al. Targeting the Hsp40/Hsp70 chaperone axis as a novel strategy to treat

castration-resistant prostate cancer. _Cancer Res._ 78, 4022–4035 (2018). Article  CAS  Google Scholar  * Heinlein, C. A. & Chang, C. Androgen receptor in prostate cancer. _Endocr. Rev._

25, 276–308 (2004). Article  CAS  Google Scholar  * Quigley, D. A. et al. Genomic hallmarks and structural variation in metastatic prostate cancer. _Cell_ 174, 758–769.e9 (2018). Article 

CAS  Google Scholar  * Gelmann, E. P. Molecular biology of the androgen receptor. _J. Clin. Oncol._ 20, 3001–3015 (2002). Article  CAS  Google Scholar  * Spada, A. R. L., Wilson, E. M.,

Lubahn, D. B., Harding, A. E. & Fischbeck, K. H. Androgen receptor gene mutations in X-linked spinal and bulbar muscular atrophy. _Nature_ 352, 77–79 (1991). Article  ADS  Google Scholar

  * Li, M. et al. Nuclear inclusions of the androgen receptor protein in spinal and bulbar muscular atrophy. _Ann. Neurol._ 44, 249–254 (1998). Article  CAS  Google Scholar  * Stenoien, D.

L. et al. Polyglutamine-expanded androgen receptors form aggregates that sequester heat shock proteins, proteasome components and SRC-1, and are suppressed by the HDJ-2 chaperone. _Hum. Mol.

Genet._ 8, 731–741 (1999). Article  CAS  Google Scholar  * Prescott, J. & Coetzee, G. A. Molecular chaperones throughout the life cycle of the androgen receptor. _Cancer Lett._ 231,

12–19 (2006). Article  CAS  Google Scholar  * Azad, A. A., Zoubeidi, A., Gleave, M. E. & Chi, K. N. Targeting heat shock proteins in metastatic castration-resistant prostate cancer.

_Nat. Rev. Urol._ 12, 26–36 (2014). Article  Google Scholar  * Dong, J. et al. Hsp70 binds to the androgen receptor N-terminal domain and modulates the receptor function in prostate cancer

cells. _Mol. Cancer Ther._ 18, 39–50 (2019). Article  CAS  Google Scholar  * Liu, C. et al. Proteostasis by STUB1/HSP70 complex controls sensitivity to androgen receptor targeted therapy in

advanced prostate cancer. _Nat. Commun._ 9, 4700 (2018). Article  ADS  Google Scholar  * Matias, P. M. et al. Structural evidence for ligand specificity in the binding domain of the human

androgen receptor: implications for pathogenic gene mutations. _J. Biol. Chem._ 275, 26164–26171 (2000). Article  CAS  Google Scholar  * Shaffer, P. L., Jivan, A., Dollins, D. E., Claessens,

F. & Gewirth, D. T. Structural basis of androgen receptor binding to selective androgen response elements. _Proc. Natl Acad. Sci. USA_ 101, 4758–4763 (2004). Article  CAS  ADS  Google

Scholar  * Eftekharzadeh, B. et al. Sequence context influences the structure and aggregation behavior of a PolyQ tract. _Biophys. J._ 110, 2361–2366 (2016). Article  CAS  ADS  Google

Scholar  * Escobedo, A. et al. Side chain to main chain hydrogen bonds stabilize a polyglutamine helix in a transcription factor. _Nat. Commun._ 10, 2034 (2019). Article  ADS  Google Scholar

  * Lavery, D. N. & McEwan, I. J. Structural characterization of the native NH2-terminal transactivation domain of the human androgen receptor: a collapsed disordered conformation

underlies structural plasticity and protein-induced folding. _Biochemistry_ 47, 3360–3369 (2008). Article  CAS  Google Scholar  * De Mol, E. et al. EPI-001, a compound active against

castration-resistant prostate cancer, targets transactivation unit 5 of the androgen receptor. _ACS Chem. Biol._ 11, 2499–2505 (2016). Article  Google Scholar  * De Mol, E. et al. Regulation

of androgen receptor activity by transient interactions of its transactivation domain with general transcription regulators. _Structure_ 26, 145–152.e3 (2018). Article  Google Scholar  *

He, B., Kemppainen, J. A. & Wilson, E. M. FXXLF and WXXLF sequences mediate the NH2-terminal interaction with the ligand binding domain of the androgen receptor. _J. Biol. Chem._ 275,

22986–22994 (2000). Article  CAS  Google Scholar  * He, B. et al. Structural basis for androgen receptor interdomain and coactivator interactions suggests a transition in nuclear receptor

activation function dominance. _Mol. Cell_ 16, 425–438 (2004). Article  CAS  Google Scholar  * Qin, J., Vinogradova, O. & Gronenborn, A. M. Protein–protein interactions probed by nuclear

magnetic resonance spectroscopy. _Methods Enzymol._ 339, 377–389 (2001). * Dyson, H. J. & Wright, P. E. Unfolded proteins and protein folding studied by NMR. _Chem. Rev._ 104, 3607–3622

(2004). Article  CAS  Google Scholar  * Tam, S. et al. The chaperonin TRiC blocks a huntingtin sequence element that promotes the conformational switch to aggregation. _Nat. Struct. Mol.

Biol._ 16, 1279–1285 (2009). Article  CAS  Google Scholar  * Monsellier, E., Redeker, V., Ruiz-Arlandis, G., Bousset, L. & Melki, R. Molecular interaction between the chaperone Hsc70 and

the N-terminal flank of huntingtin exon 1 modulates aggregation. _J. Biol. Chem._ 290, 2560–2576 (2015). Article  CAS  Google Scholar  * Clerico, E. M., Tilitsky, J. M., Meng, W. &

Gierasch, L. M. How hsp70 molecular machines interact with their substrates to mediate diverse physiological functions. _J. Mol. Biol._ 427, 1575–1588 (2015). Article  CAS  Google Scholar  *

Schmid, D., Baici, A., Gehring, H. & Christen, P. Kinetics of molecular chaperone action. _Science_ 263, 971–973 (1994). Article  CAS  ADS  Google Scholar  * Karagöz, G. E. et al.

Hsp90-Tau complex reveals molecular basis for specificity in chaperone action. _Cell_ 156, 963–974 (2014). Article  Google Scholar  * Rudiger, S., Schneider-Mergener, J. & Bukau, B. Its

substrate specificity characterizes the DnaJ co-chaperone as a scanning factor for the DnaK chaperone. _EMBO J_. 20, 1042–1050 (2001). * Srinivasan, S. R., Gillies, A. T., Chang, L.,

Thompson, A. D. & Gestwicki, J. E. Molecular chaperones DnaK and DnaJ share predicted binding sites on most proteins in the E. coli proteome. _Mol. Biosyst._ 8, 2323–2333 (2012). Article

  CAS  Google Scholar  * Rose, G. D., Geselowitz, A. R., Lesser, G. J., Lee, R. H. & Zehfus, M. H. Hydrophobicity of amino acid residues in globular proteins. _Science_ 229, 834–838

(1985). Article  CAS  ADS  Google Scholar  * Rüdiger, S., Germeroth, L., Schneider-Mergener, J. & Bukau, B. Substrate specificity of the DnaK chaperone determined by screening

cellulose-bound peptide libraries. _EMBO J._ 16, 1501–1507 (1997). Article  Google Scholar  * Taylor, I. R. et al. The disorderly conduct of Hsc70 and its interaction with the Alzheimer’s

related Tau protein. _J. Biol. Chem._ 293, 10796–10809 (2018). Article  CAS  Google Scholar  * Söderberg, O. et al. Direct observation of individual endogenous protein complexes in situ by

proximity ligation. _Nat. Methods_ 3, 995–1000 (2006). Article  Google Scholar  * Zboray, L. et al. Preventing the androgen receptor n/c interaction delays disease onset in a mouse model of

SBMA. _Cell Rep._ 13, 2312–2323 (2015). Article  CAS  Google Scholar  * Katsuno, M. et al. Testosterone reduction prevents phenotypic expression in a transgenic mouse model of spinal and

bulbar muscular atrophy. _Neuron_ 35, 843–854 (2002). Article  CAS  Google Scholar  * Takeyama, K.-I. et al. Androgen-dependent neurodegeneration by polyglutamine-expanded human androgen

receptor in Drosophila. _Neuron_ 35, 855–864 (2002). Article  CAS  Google Scholar  * Chevalier-Larsen, E. S. et al. Castration restores function and neurofilament alterations of aged

symptomatic males in a transgenic mouse model of spinal and bulbar muscular atrophy. _J. Neurosci._ 24, 4778–4786 (2004). Article  CAS  Google Scholar  * Yu, Z. et al. Androgen-dependent

pathology demonstrates myopathic contribution to the Kennedy disease phenotype in a mouse knock-in model. _J. Clin. Invest._ 116, 2663–2672 (2006). Article  CAS  Google Scholar  * Fawzi, N.

L., Ying, J., Torchia, D. A. & Clore, G. M. Kinetics of amyloid beta monomer-to-oligomer exchange by NMR relaxation. _J. Am. Chem. Soc._ 132, 9948–9951 (2010). Article  CAS  Google

Scholar  * Jayaraman, M. et al. Slow amyloid nucleation via α-helix-rich oligomeric intermediates in short polyglutamine-containing huntingtin fragments. _J. Mol. Biol._ 415, 881–899 (2012).

Article  CAS  Google Scholar  * Wetzel, R. Physical chemistry of polyglutamine: intriguing tales of a monotonous sequence. _J. Mol. Biol_. 421, 466–490 (2012). * Young, Z. T. et al.

Stabilizing the Hsp70-Tau complex promotes turnover in models of tauopathy. _Cell Chem. Biol._ 23, 992–1001 (2016). Article  CAS  Google Scholar  * Mayer, M. P. & Bukau, B. Hsp70

chaperones: cellular functions and molecular mechanism. _Cell. Mol. Life Sci._ 62, 670–684 (2005). Article  CAS  Google Scholar  * Rousaki, A. et al. Allosteric drugs: the interaction of

antitumor compound MKT-077 with human Hsp70 chaperones. _J. Mol. Biol._ 411, 614–632 (2011). Article  CAS  Google Scholar  * Walcott, J. L. & Merry, D. E. Ligand promotes intranuclear

inclusions in a novel cell model of spinal and bulbar muscular atrophy. _J. Biol. Chem._ 277, 50855–50859 (2002). Article  CAS  Google Scholar  * Shao, H. et al. Exploration of benzothiazole

rhodacyanines as allosteric inhibitors of protein-protein interactions with heat shock protein 70 (Hsp70). _J. Med. Chem._ 61, 6163–6177 (2018). Article  CAS  Google Scholar  * Yu, Z. et

al. Abnormalities of germ cell maturation and sertoli cell cytoskeleton in androgen receptor 113 CAG knock-in mice reveal toxic effects of the mutant protein. _Am. J. Pathol._ 168, 195–204

(2006). Article  CAS  Google Scholar  * De Los Rios, P. & Barducci, A. Hsp70 chaperones are non-equilibrium machines that achieve ultra-affinity by energy consumption. _Elife_ 3, e02218

(2014). Article  Google Scholar  * Cesa, L. C. et al. X-linked inhibitor of apoptosis protein (XIAP) is a client of heat shock protein 70 (Hsp70) and a biomarker of its inhibition. _J. Biol.

Chem._ 293, 2370–2380 (2018). Article  CAS  Google Scholar  * Lieberman, A. P. Spinal and bulbar muscular atrophy. _Handb. Clin. Neurol._ 148, 625–632 (2018). Article  Google Scholar  *

Lieberman, A. P., Shakkottai, V. G. & Albin, R. L. Polyglutamine repeats in neurodegenerative diseases. _Annu. Rev. Pathol_. https://doi.org/10.1146/annurev-pathmechdis-012418-012857

(2018) * Pratt, W. B., Morishima, Y., Gestwicki, J. E., Lieberman, A. P. & Osawa, Y. A model in which heat shock protein 90 targets protein-folding clefts: rationale for a new approach

to neuroprotective treatment of protein folding diseases. _Exp. Biol. Med._ 239, 1405–1413 (2014). Article  Google Scholar  * Roth, D. M. et al. Modulation of the maladaptive stress response

to manage diseases of protein folding. _PLoS Biol._ 12, e1001998 (2014). Article  Google Scholar  * Delaglio, F. et al. NMRPipe: a multidimensional spectral processing system based on UNIX

pipes. _J. Biomol. NMR_ 6, 277–293 (1995). Article  CAS  Google Scholar  * Vranken, W. F. et al. The CCPN data model for NMR spectroscopy: development of a software pipeline. _Proteins_ 59,

687–696 (2005). Article  CAS  Google Scholar  * Weiss, A. et al. Sensitive biochemical aggregate detection reveals aggregation onset before symptom development in cellular and murine models

of Huntington’s disease. _J. Neurochem._ 104, 846–858 (2008). CAS  PubMed  Google Scholar  * Romero, P. et al. Sequence complexity of disordered protein. _Protein.: Struct. Funct. Bioinf._

42, 38–48 (2001). Article  CAS  Google Scholar  Download references ACKNOWLEDGEMENTS X.S. acknowledges funding from Obra Social “la Caixa”, AGAUR (2017 SGR 324), Marató TV3 (102030), MINECO

(BIO2012-31043 and BIO2015-70092-R) and the European Research Council (CONCERT, contract number 648201). IRB Barcelona is the recipient of a Severo Ochoa Award of Excellence from MINECO

(Government of Spain). A.P.L. acknowledges funding from NIH (NS055746). J.E.G. acknowledges funding from NIH (NS059690). S.R.N. was supported by a Rackham Predoctoral Fellowship and by the

NIH (GM007863). AUTHOR INFORMATION Author notes * These authors contributed equally: Bahareh Eftekharzadeh, Varuna C. Banduseela, Giulio Chiesa, Paula Martínez-Cristóbal. AUTHORS AND

AFFILIATIONS * Institute for Research in Biomedicine (IRB Barcelona), The Barcelona Institute of Science and Technology, Baldiri Reixac 10, 08028, Barcelona, Spain Bahareh Eftekharzadeh, 

Giulio Chiesa, Paula Martínez-Cristóbal, Marta Marin-Argany, Claudio Di Sanza, Isabelle Brun-Heath, Jesús García, Ángel R. Nebreda & Xavier Salvatella * Joint BSC-IRB Research Programme

in Computational Biology, Baldiri Reixac 10, 08028, Barcelona, Spain Bahareh Eftekharzadeh, Giulio Chiesa, Paula Martínez-Cristóbal, Marta Marin-Argany, Claudio Di Sanza, Isabelle Brun-Heath

 & Xavier Salvatella * Department of Pathology, University of Michigan, Ann Arbor, MI, 48109, USA Varuna C. Banduseela, Samir R. Nath, Elisa Giorgetti, Zhigang Yu & Andrew P.

Lieberman * University of California at San Francisco, Department of Pharmaceutical Chemistry, 675 Nelson Rising Lane, San Francisco, CA, 94158, USA Jennifer N. Rauch, Daniel M. C. Schwarz, 

Hao Shao & Jason E. Gestwicki * CERM and Department of Chemistry “Ugo Schiff”, University of Florence, Via Luigi Sacconi 6, 50019, Sesto Fiorentino, Florence, Italy Roberta Pierattelli 

& Isabella C. Felli * ICREA, Passeig Lluís Companys 23, 08010, Barcelona, Spain Ángel R. Nebreda & Xavier Salvatella Authors * Bahareh Eftekharzadeh View author publications You can

also search for this author inPubMed Google Scholar * Varuna C. Banduseela View author publications You can also search for this author inPubMed Google Scholar * Giulio Chiesa View author

publications You can also search for this author inPubMed Google Scholar * Paula Martínez-Cristóbal View author publications You can also search for this author inPubMed Google Scholar *

Jennifer N. Rauch View author publications You can also search for this author inPubMed Google Scholar * Samir R. Nath View author publications You can also search for this author inPubMed 

Google Scholar * Daniel M. C. Schwarz View author publications You can also search for this author inPubMed Google Scholar * Hao Shao View author publications You can also search for this

author inPubMed Google Scholar * Marta Marin-Argany View author publications You can also search for this author inPubMed Google Scholar * Claudio Di Sanza View author publications You can

also search for this author inPubMed Google Scholar * Elisa Giorgetti View author publications You can also search for this author inPubMed Google Scholar * Zhigang Yu View author

publications You can also search for this author inPubMed Google Scholar * Roberta Pierattelli View author publications You can also search for this author inPubMed Google Scholar * Isabella

C. Felli View author publications You can also search for this author inPubMed Google Scholar * Isabelle Brun-Heath View author publications You can also search for this author inPubMed 

Google Scholar * Jesús García View author publications You can also search for this author inPubMed Google Scholar * Ángel R. Nebreda View author publications You can also search for this

author inPubMed Google Scholar * Jason E. Gestwicki View author publications You can also search for this author inPubMed Google Scholar * Andrew P. Lieberman View author publications You

can also search for this author inPubMed Google Scholar * Xavier Salvatella View author publications You can also search for this author inPubMed Google Scholar CONTRIBUTIONS B.E., M.M.,

J.G, and X.S. carried out and analyzed NMR experiments. G.C. set up a protocol to express, purify, and study the aggregation of NTD1-155. J.N.R., D.M.C.S., and H.S. carried out FP and ITC

experiments. P.M-C. and C.D.S. carried out PLA, WB, and IF experiments. V.C.B., E.G., and S.R.N. analyzed effects of Hsp70-targeted small molecules in cell culture. V.C.B. and Z.Y. analyzed

effects of Hsp70-targeted molecules in mice. R.P., I.C.F., I.B-H. and A.N. contributed to the analysis and interpretation of the results. J.E.G., A.P.L. and X.S. conceived and led the

project and also wrote the first draft of the paper. All authors contributed to the final version. CORRESPONDING AUTHORS Correspondence to Jason E. Gestwicki, Andrew P. Lieberman or Xavier

Salvatella. ETHICS DECLARATIONS COMPETING INTERESTS The authors declare no competing interests. ADDITIONAL INFORMATION PEER REVIEW INFORMATION: _Nature Communications_ thanks Lila Gierasch,

Harry T. Orr and the other anonymous reviewer for their contribution to the peer review of this work. Peer reviewer reports are available PUBLISHER’S NOTE: Springer Nature remains neutral

with regard to jurisdictional claims in published maps and institutional affiliations. SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION PEER REVIEW FILE REPORTING SUMMARY SOURCE DATA

SOURCE DATA RIGHTS AND PERMISSIONS OPEN ACCESS This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution

and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if

changes were made. The images or other third party material in this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the

material. If material is not included in the article’s Creative Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to

obtain permission directly from the copyright holder. To view a copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Reprints and permissions ABOUT THIS ARTICLE CITE THIS

ARTICLE Eftekharzadeh, B., Banduseela, V.C., Chiesa, G. _et al._ Hsp70 and Hsp40 inhibit an inter-domain interaction necessary for transcriptional activity in the androgen receptor. _Nat

Commun_ 10, 3562 (2019). https://doi.org/10.1038/s41467-019-11594-y Download citation * Received: 04 January 2019 * Accepted: 23 July 2019 * Published: 08 August 2019 * DOI:

https://doi.org/10.1038/s41467-019-11594-y SHARE THIS ARTICLE Anyone you share the following link with will be able to read this content: Get shareable link Sorry, a shareable link is not

currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt content-sharing initiative