Acrif9 tethers non-sequence specific dsdna to the crispr rna-guided surveillance complex


Acrif9 tethers non-sequence specific dsdna to the crispr rna-guided surveillance complex

Play all audios:


ABSTRACT Bacteria have evolved sophisticated adaptive immune systems, called CRISPR-Cas, that provide sequence-specific protection against phage infection. In turn, phages have evolved a


broad spectrum of anti-CRISPRs that suppress these immune systems. Here we report structures of anti-CRISPR protein IF9 (AcrIF9) in complex with the type I-F CRISPR RNA-guided surveillance


complex (Csy). In addition to sterically blocking the hybridization of complementary dsDNA to the CRISPR RNA, our results show that AcrIF9 binding also promotes non-sequence-specific


engagement with dsDNA, potentially sequestering the complex from target DNA. These findings highlight the versatility of anti-CRISPR mechanisms utilized by phages to suppress CRISPR-mediated


immune systems. SIMILAR CONTENT BEING VIEWED BY OTHERS INSIGHTS INTO THE INHIBITION OF TYPE I-F CRISPR-CAS SYSTEM BY A MULTIFUNCTIONAL ANTI-CRISPR PROTEIN ACRIF24 Article Open access 11


April 2022 DISARMING OF TYPE I-F CRISPR-CAS SURVEILLANCE COMPLEX BY ANTI-CRISPR PROTEINS ACRIF6 AND ACRIF9 Article Open access 15 September 2022 PRO-CRISPR PCRIIC1-ASSOCIATED CAS9 SYSTEM FOR


ENHANCED BACTERIAL IMMUNITY Article 29 May 2024 INTRODUCTION Bacteria and archaea acquire immunity to viruses and other genetic parasites by preferentially integrating short fragments of


foreign DNA into one end of a clustered regularly interspaced short palindromic repeat (CRISPR) locus1,2,3. CRISPR loci are transcribed and the long primary transcript is processed into a


library of short CRISPR-derived RNAs (crRNA) that guide CRISPR-associated (Cas) proteins to complementary targets for nuclease-mediated degradation4,5. A diverse arsenal of CRISPR-Cas immune


systems, comprising two classes, six types, and 32 subtypes, provide adaptive and heritable defense from genetic parasites6,7. In turn, phages and other parasites have evolved an equally


varied repertoire of anti-CRISPR proteins8. Here we set out to determine the mechanism of immune system suppression by the previously identified, but mechanistically uncharacterized,


anti-CRISPR protein IF9 (AcrIF9) that specifically inhibits the type I-F immune system in _Pseudomonas aeruginosa_9. We show that AcrIF9 inhibits the crRNA-guided surveillance complex (Csy)


by sterically blocking the hybridization of target DNA to the crRNA guide. Interestingly, AcrIF9 bound to Csy, also promotes non-specific interactions with dsDNA, potentially sequestering


the surveillance complex away from target DNA and thereby providing an additional layer of immune suppression. RESULTS THE CRYO-EM STRUCTURE OF THE CSY–ACRIF9 COMPLEX In order to determine


the mechanism of immune suppression by AcrIF9, we co-expressed and purified the Csy with AcrIF9 and determined the structure using cryo-electron microscopy (cryo-EM) at a nominal resolution


of ~3.9Å (Fig. 1, Supplementary Fig. 1, and Supplementary Table 1). Overall, the complex maintains the previously described seahorse-shape, comprising a hexameric Cas7f “backbone” that is


capped on one end by the Cas6f “head”, while the other end is capped by a heterodimeric Cas8f and Cas5f “tail”. The Cas7f subunits are each shaped like a “right-hand” and two molecules of


AcrIF9 (AcrIF9.1 and AcrIF9.2) bind the “thumbs” of the Cas7.4f and Cas7.6f subunits, respectively (Fig. 1a). The positioning of the AcrIF9 molecules is reminiscent of the anti-CRISPR AcrIF1


(Supplementary Fig. 2), which has previously been shown to sterically block access to the crRNA-guide for the complementary DNA target10,11. AcrIF9 is a 7.9 kDa protein made up of a five


stranded, anti-parallel beta sheet cradling an alpha helix (Fig. 1b), a fold distinct from AcrIF1 (Supplementary Fig. 2). Both AcrIF9 molecules form extensive interactions with the thumbs of


Cas7f (Fig. 1c, d), accounting for ~30% of the total solvent accessible surface area of AcrIF9. The two AcrIF9 binding sites are similar, and the specific residues interacting with each of


the AcrIF9 molecules superimpose with an r.m.s.d. of 1.4 Å (see “Methods”). The contacts include a hydrogen bonding network between AcrIF9 residues Q11 to S15, and N94 and Q96 in Cas7f. In


addition, Q11 of AcrIF9 also hydrogen bonds with a nucleobase from the crRNA (C13 to AcrIF9.1 and U25 to AcrIF9.2 respectively, Fig. 1c). A second cluster of hydrogen bonding interactions is


found between AcrIF9 R17 and residues S89 and S92 in the Cas7f thumb (Fig. 1d). Furthermore, the aromatic sidechains of AcrIF9 residues F39, F40, and H41 form an “aromatic clamp” around


residues L76 to T78 of Cas7f and additional hydrogen bonding occurs between AcrIF9 residues Q38 to H41 and Cas7f residues R75 to T78 (Fig. 1d). AcrIF9.1, but not AcrIF9.2, also interacts


with Cas8f through hydrogen bonding of the Cas8f R224 carbonyl with AcrIF9.1 the L27 backbone nitrogen (Fig. 1e). While additional interactions between AcrIF9.1 and Cas8f are expected, the


local resolution limits confident assignment of additional interactions at this interface. THE CSY–ACRIF9 COMPLEX TRIGGERS NON-SPECIFIC DNA BINDING Based on the similarity of the binding


sites for AcrIF1 and AcrIF9, we predicted that AcrIF9 would sterically block target binding. To test this hypothesis, we performed electrophoretic mobility shift assays (EMSA) to determine


whether AcrIF9 is capable of inhibiting crRNA-guided interactions with target DNA (Fig. 2a). While target dsDNA (i.e., protospacer and PAM) binding is inhibited at sub-stoichiometric


concentrations of AcrIF9 to Csy, dsDNA binding is unexpectedly restored at higher stoichiometric ratios of AcrIF9. EMSAs performed with non-target dsDNA (i.e., no protospacer) exhibited


similar results (Fig. 2a). This result suggests that the formation of the ternary complex (i.e., Csy–AcrIF9–dsDNA) does not rely on base-pairing interactions and is fundamentally different


than target DNA hybridization to the crRNA guide12,13,14. This binding behavior specifically requires the Csy–AcrIF9 complex, as AcrIF9 alone does not bind dsDNA (Fig. 2a and Supplementary


Fig. 3). THE CRYO-EM STRUCTURE OF THE CSY–ACRIF9–DSDNA COMPLEX To discern how interactions between AcrIF9 and Csy trigger binding to non-sequence-specific dsDNA, we next determined the


structure of the Csy–AcrIF9 complex bound to dsDNA at a nominal resolution of ~4.2 Å (Fig. 2b, Supplementary Fig. 4, and Supplementary Table 1). The reconstruction reveals two stretches of


non-contiguous helical density that are not accounted for by Csy or AcrIF9 but are consistent with the size and shape of B-form DNA (Fig. 2b–d). The model reveals that both dsDNA segments


are interacting with a positive patch on AcrIF9. Additionally, the dsDNA segment bound nearest Cas7.6f, interacts with residues from the Cas8f N-terminal hook (Fig. 2e). Notably, the


positive patch on AcrIF9 is composed of five conserved residues (K31, R32, K36, K58, and R63) (Supplementary Fig. 515). We attempted to make structure-guided mutations of these residues


(AcrIF9K31A,R32A,K36A, AcrIF9K31Q,R32Q, and AcrIF9K31E,R32E). While the mutants express and purify similar to wild-type AcrIF9, the size exclusion profiles are distinct (Supplementary Fig. 


6). In addition, the mutants are defective for blocking crRNA-guided interactions with DNA targets. Collectively, these observations suggest the mutations result in a folding defect that


reduces the affinity for Csy. DISCUSSION Collectively, the structures and biochemistry presented here suggest a two-pronged mechanism for AcrIF9-mediated immune suppression. Similar to


AcrIF1, AcrIF9 inhibits the surveillance system by sterically blocking crRNA-guided binding to complementary DNA. While this manuscript was under review, Zhang et al. published a Csy–AcrIF9


structure and similarly concluded that AcrIF9 inhibits target-DNA hybridization to the crRNA guide16. The two Csy–AcrIF9 models are nearly identical and align with an all-atom r.m.s.d. of


3.7 Å. Here, we provide additional insights into AcrIF9 function and show how the Csy–AcrIF9 complex promotes the binding of dsDNA in a non-sequence-specific manner. A similar phenomenon has


recently been reported for AcrIIA11, an anti-CRISPR targeting Cas917, although structural information is currently unavailable. We suggest that Acr-triggered interactions with


non-sequence-specific dsDNA could represent an additional layer of immune suppression by sequestering the surveillance system through non-productive associations with dsDNA. However, future


experiments are required to reveal the importance and prevalence of Acr-induced non-specific DNA sequestration. METHODS PURIFICATION OF THE CSY COMPLEX Csy genes and a synthetic CRISPR were


co-expressed on separate vectors (Addgene IDs: 89232 and 89244) in _Escherichia coli_ BL21 (DE3) cells (NEB)18,19. The expression was induced with 0.5 mM isopropyl-d-1-thiogalactopyranoside


(IPTG) at an optical density (OD600 nm) of 0.5. Cells were incubated overnight at 16 °C, then pelleted by centrifugation (5000 × _g_ for 15 min at 4 °C) and re-suspended in lysis buffer


containing 50 mM 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid (HEPES) at pH 7.5, 300 mM potassium chloride, 5% glycerol, 1 mM Tris(2-carboxyethyl) phosphine hydrochloride (TCEP), and


1× protease inhibitor cocktail (Thermo Scientific). Pellets were sonicated on ice for 3 × 2.5 min (1 s on followed by 3 s off). The lysate was clarified by centrifugation at 22,000×_g_ for


30 min at 4 °C. The Csy complex self-assembles in vivo and the His-tagged complex (N-terminal 6-histidine affinity tags on Cas7f) was affinity purified using Ni-NTA resin (QIAGEN). The resin


was washed with five column volumes of lysis buffer supplemented with 20 mM imidazole before elution with lysis buffer supplemented with 300 mM imidazole. Protein was then concentrated


(Corning Spin-X concentrators) at 4 °C prior to size-exclusion chromatography (Superdex 200, GE Healthcare) in 20 mM HEPES, pH 7.5, 100 mM KCl, 5% glycerol, and 1 mM TCEP. ACRIF9


PURIFICATION AcrIF9 from _Proteus penneri_ (EEG86164.1) was cloned into pMAL-c4x, downstream of an N-terminal maltose binding protein (MBP) and an HRV-3C protease site (Addgene ID: 141442).


Primer sequences used for cloning are as follows; forward TTCCAAGGTCCTATGAAAAGCACATACATCATC, and reverse AAGAACTTCAAGGAATTCTGAAATCCTTCCC. The expression plasmid was transformed into _E.


coli_ BL21 (DE3) cells and protein expression was induced with IPTG at an optical density (OD600 nm) of 0.5. Cells were pelleted and lysed as described above. AcrIF9 was purified in lysis


buffer (50 mM Tris, pH 7.5, 300 mM NaCl, 5% glycerol), which was supplemented with 10 mM maltose for elution off MBP resin (GE Healthcare). The protein was concentrated (Corning Spin-X


concentrators) at 4 °C prior to size-exclusion chromatography (Superdex 75, GE Healthcare) in 20 mM Tris, pH 7.5, 100 mM NaCl, and 5% glycerol. The MBP tag was removed with HRV-3C protease


and the tag was separated from AcrIF9 using size-exclusion chromatography (Superdex 75, GE Healthcare) in 20 mM Tris, pH 7.5, 100 mM NaCl, and 5% glycerol. PURIFICATION OF CSY–ACRIF9 COMPLEX


Csy genes (Addgene ID: 89232), a synthetic CRISPR (Addgene ID: 89244), and AcrIF9 (GenBank: EEG86164.1 cloned into pCDF-1b) were co-expressed on separate vectors, as described above. The


Csy–AcrIF9 complex was purified using methods similar to those described for the Csy complex, except size exclusion was performed using a Superdex 200 26/600 column (GE Healthcare),


equilibrated in 20 mM HEPES, pH 7.5, 100 mM NaCl, 5% glycerol, and 1 mM TCEP. PURIFICATION OF CSY–ACRIF9–DSDNA COMPLEX Purified Csy was first incubated with a 4-fold excess of AcrIF9 in


buffer (20 mM HEPES, pH 7.5, 100 mM NaCl, 5% glycerol, and 1 mM TCEP) at 37 °C for 15 min. Purified non-target dsDNA (described below) was then added at a 2.5-fold excess over Csy and


incubated for an additional 15 min at 37 °C. Csy–AcrIF9–dsDNA complex was then purified using a Superdex 200 10/300 size exclusion column (GE Healthcare) and the sample was concentrated


using a 100 kDa MWCO concentrator (Pierce). NUCLEIC ACID PREPARATION All ssDNAs were purchased from Eurofins Genomics and purified by reverse-phase high-performance liquid chromatography.


Specific (5′-GCTGTACGTCACTATCGAAGCAATACAGGTAGACGCGGACATCAAGCCCGCCGTGAAGGTGCAGCTTCTCTACAGAGTGC-3′) and non-specific


(5′-GCAGCTCGAGTTAAGACGGTATTGTTCAGATCCTGGCTTGCCAACAGTGATTTGCTCATTTTGTAGATTGAGTCGCT-3′) DNA targets (1 pmol) were labeled at the 5′-end with 2 pmol of [γ-32P]ATP (PerkinElmer), using T4


polynucleotide kinase (NEB) in 1× polynucleotide kinase buffer at 37 °C for 45 min20. Polynucleotide kinase was heat-denatured by incubation at 65 °C for 20 min. Unincorporated [γ-32P]ATP


was removed from the reaction using gel filtration spin columns (G-25, GE Healthcare). 32P-labeled ssDNAs were mixed with a 10-fold excess of unlabeled complementary ssDNA, in 20 mM


Tris–HCl, pH 7.5, 100 mM KCl, 5 mM MgCl2. DNA mixtures were denatured at 95 °C for 5 min, and then annealed by slow cooling to room temperature over 1 h. 32P-labeled dsDNAs were purified by


native gel electrophoresis, ethanol precipitated, and resuspended in 10 mM Tris–HCl, pH 7.5, 50 mM NaCl, 1 mM ethylenediaminetetraacetic acid. ELECTROPHORETIC MOBILITY SHIFT ASSAY Binding


assays were performed by incubating increasing concentrations of AcrIF9 with 200 nM Csy complex in reaction buffer (20 mM HEPES, pH 7.5, 100 mM potassium acetate, 5% glycerol, 1 mM TCEP) for


15 min at 37 °C. Reactions were moved to ice and <0.5 nM of 5′ 32P-labeled DNA oligonucleotides were added. Reactions were then incubated for 15 min at 37 °C. Reaction products were run


on native, 6% polyacrylamide gels, which were dried and imaged with a phosphor storage screen (Kodak), then scanned with a Typhoon phosphorimager (GE Healthcare). ELECTRON MICROSCOPE SAMPLE


PREPARATION Csy–Acr complexes were previously found to exhibit preferred orientation when suspended in open holes during preparation for cryo-EM imaging10. Therefore, purified Csy–AcrIF9 was


mixed with 0.05% v v−1 Lauryl Maltose Neopentyl Glycol prior to freezing. UltrAuFoil R1.2/1.3 300-mesh grids (Electron Microscopy Sciences) were plasma cleaned immediately prior to sample


application in a Solarus plasma cleaner (Gatan, Inc.) with a 75% nitrogen, 25% oxygen atmosphere at 15 W for 7 s. Cryo-EM grids were prepared by application of 4 µL Csy–AcrF9 at a


concentration of 2.5 mg mL−1. Grids were manually blotted with Whatman No. 1 filter paper for 5 s followed by plunge freezing in liquid ethane at 4 °C in 95% humidity. CRYO-EM DATA


ACQUISITION Cryo-EM data was collected using the Leginon21 automated data collection software on a Talos Arctica (Thermo Fisher) TEM operating at 200 keV equipped with a K2 Summit direct


electron detector (Gatan, Inc.) in counting mode. Movies were collected at a nominal magnification of 36,000× with a physical pixel size of 1.15 Å pixel−1. A total of 1860 movies were


collected with a 200 ms frame rate and a total exposure time of 13.1 s. An exposure rate of ~5 electrons pixel−1 s−1 was used, resulting in a cumulative exposure of 66 electrons Å−2. Data


were acquired using a nominal defocus range of 0.8–1.2 Å. To improve the Euler distribution, grids were tilted to 30° during imaging22. Preprocessing was performed in real-time to monitor


data quality using the Appion image processing pipeline23. Frame alignment, CTF estimation, and particle picking were performed with MotionCorr224, Gctf25, and DoGpicker26, respectively.


Data collection on the Csy–AcrIF9–dsDNA sample was performed as described above with the following exceptions: a total of 3413 movies were collected tilted to 30° and 3059 images were


collected untilted with a total exposure time of 12 s and 100 ms frame rate. CSY–ACRIF9 CRYO-EM DATA PROCESSING Movies of the Csy–AcrIF9 complex were aligned and dose-weighted using


Motioncorr2 in Relion 3.0 on 5 × 5 frames with an applied B-factor of 15027. Unweighted aligned images were used for CTF estimation in Gctf25. Difference of Gaussian26 picker was used to


pick particles from the first 1017 dose-weighted aligned images and particles were extracted binned 4 × 4 (4.6 Å pixel−1, 48-pixel box size). Reference-free 2D classification was performed


on the particle stack to generate templates. One top view and one tilt view were selected as templates and used for template picking of all movies, resulting in a total of 1.57 million picks


that were extracted binned 4 × 4 (4.6 Å pixel−1, 48-pixel box size). The particle stack was subjected to reference-free 2D classification and non-particle picks were eliminated from the


stack. This particle stack of 1.53 million particles was input to 3D auto-refinement. An initial model was obtained from a stack generated by Appion during data collection of the first 500


images. The stack was uploaded to CryoSparc28 and subjected to 2D classification. 2D averages showing secondary structure elements were selected and used to generate an ab initio 3D model.


This model was imported into Relion and used as a reference for 3D auto-refinement of the 1.53 M particle stack. The coordinates of the particles were re-centered based on the alignment


parameters of the reconstruction, and the particles were re-extracted at a binning of 2 × 2 (2.3 Å pixel−1, 96-pixel box size) and subjected to 3D classification (3 classes, tau-value 10,


performing angular and translational searches). The 314,854 particles contributing to the one high-resolution 3D class were re-centered and re-extracted at full resolution (1.15 Å pixel−1,


192-pixel box size). The unbinned stack refined to a nominal resolution of 6.6 Å using a mask generated by converting the Csy–AcrIF1/AcrIF2 structure (PDB ID: 5uz9) into a low-resolution


density map using the “molmap” function in Chimera29, and then subsequently applying a 4-pixel extension and 8-pixel soft cosine edge using Relion. The resulting reconstruction was low-pass


filtered to 15 Å for use in generating a new soft mask with a 4-pixel extension and 8-pixel soft cosine edge. The particles were grouped by image shift and iteratively CTF refined with beam


tilt and per-particle astigmatism correction followed by auto-refinement. Four rounds of CTF refinement and auto-refinement led to a reconstruction with nominal resolution of 4.3 Å.


Subsequent particle polishing and a final round of CTF refinement resulted in an improved map with a resolution of ~3.9 Å. The local resolution was estimated using the blocres program from


the Bsoft package30. CSY–ACRIF9–DSDNA CRYO-EM DATA PROCESSING Movies of the Csy–AcrIF9–dsDNA complex were aligned and dose-weighted in the Appion pipeline using Motioncorr2 on 5 × 5 frames


with an applied B-factor of 100. The aligned and dose-weighted micrographs were imported into Cryosparc v2.14.2 and patch CTF estimation was performed. One top view, one side view, and one


tilt view from the Csy–AcrIF9 dataset were selected as templates and used for template picking of all micrographs, resulting in a total of 1.91 million picks that were extracted unbinned


(1.15 Å pixel−1, 192-pixel box size). Particle pick inspection was performed to remove false picks or damaged, denatured, or aggregated particles, resulting in a stack of 1.05 million


particles. This particle stack was input to 3D heterogeneous refinement with 4 classes, a reconstruction of the Csy complex (without Acr bound) was used as an input model. One resulting


class with high-resolution details, containing 505,563 particles, was selected for further processing. Two subsequent rounds of heterogeneous refinement with 3 classes were performed using


the previous result as input model and selection of the highest resolution class. After the third round, heterogeneous refinement did not further benefit the quality and resolution of the


reconstruction. This particle stack, containing 152,066 particles, was refined using non-uniform refinement to a reported resolution of 4.2 Å. The resulting particle stack was imported into


Relion 3.1. The Cryosparc reconstruction was low-pass filtered to 15 Å for use in generating a new soft mask with a 4-pixel extension and 8-pixel soft cosine edge. The stack was auto-refined


to a reconstruction with a nominal resolution of 4.5 Å. The particles were grouped by image shift and iteratively CTF refined with beam tilt and per-particle astigmatism correction followed


by auto-refinement. Ctf refinement followed by auto-refinement led to a reconstruction with a nominal resolution of 4.2 Å. Subsequently, the local resolution was estimated as described


above using Bsoft30. ATOMIC MODEL BUILDING AND REFINEMENT The atomic model was built and real-space refined in Coot constrained to ideal geometry and secondary structure, where appropriate.


The model of Csy–AcrIF1/AcrIF2 structure (PDB ID: 5uz9), stripped of AcrIF1/AcrIF2, was rigid body fit into the EM-density map as a whole and subsequently by chain. The model was refined


into the density with application of Geman–McClure distance restraints generated in ProSMART31. The model was manually inspected and adjusted where required, specifically loop regions of the


Cas7f thumb, web and residues 291–296 were rebuilt. Sidechains were removed where supporting cryo-EM density was lacking, most notably in the regions of the head and the helical bundle of


Cas8f. The model for AcrIF9 was built de novo by placing idealized helices and ß-strands in the EM density. Loops were built into the density connecting the secondary structure elements.


Bulky sidechains were built and used to determine the register of the model. Sidechains were built using optimal rotamer conformations as indicated by the cryo-EM density. In order to build


the atomic model for Csy–AcrIF9–dsDNA, the Csy–AcrIF9 model, the Cas8f N-terminal hook from the Csy–AcrIF1/AcrIF2 structure (PDB ID: 5uz9) and idealized B-form DNA were rigid body fit into


the EM-density map. The model was refined into the density with application of Geman–McClure distance restraints generated in ProSMART31. As the density does not allow for the identification


of the DNA bases the model was trimmed to backbone atoms. The models were iteratively real-space refined by global minimization and rigid body refinement using the Phenix32 command line and


Coot33, each adhering to ideal geometry and secondary structure using Ramachandran and secondary structural constraints in Phenix. The model was further optimized for compliance to


geometric constraints using Molprobity34. Figures were rendered in ChimeraX35. In order to compare the AcrIF9 binding sites, the AcrIF9 molecules were superimposed using Pymol followed by


calculation of the all-atom r.m.s.d. between the Csy residues within 4 Å from AcrIF9.1 or AcrIF9.2. The residues within 4 Å from AcrIF9.1 are Cas7.4f 72–78, 85–86, 89, 92–96, and 258–262 and


crRNA residues 24 and 25, the residues within 4 Å from AcrIF9.2 are Cas7.6f 72–78, 85–86, 89, 92–96, and 258–262 and crRNA residues 12 and 13. REPORTING SUMMARY Further information on


research design is available in the Nature Research Reporting Summary linked to this article. DATA AVAILABILITY The cryo-EM maps of Csy–AcrIF9 and Csy–AcrIF9–dsDNA have been deposited in the


Electron Microscopy Data Bank (EMDB) under the accession codes EMD-21516 and EMD-21517, respectively. Atomic coordinates of the models have been deposited in the Protein Data Bank (PDB)


under accession codes 6W1X and 6WHI. Data for Fig. 2a and Supplementary Figs. 1a, 3, 4a, and 6b are provided as a Source Data file. Other data are available from the corresponding authors


upon request. REFERENCES * McGinn, J. & Marraffini, L. A. Molecular mechanisms of CRISPR-Cas spacer acquisition. _Nat. Rev. Microbiol._ 17, 7–12 (2019). Article  CAS  Google Scholar  *


Jackson, S. A. et al. CRISPR-Cas: adapting to change . _Science_ 356, eaal5056 (2017). Article  Google Scholar  * Barrangou, R. et al. CRISPR provides acquired resistance against viruses in


prokaryotes. _Science_ 315, 1709–1712 (2007). Article  ADS  CAS  Google Scholar  * Jackson, R. N., van Erp, P. B., Sternberg, S. H. & Wiedenheft, B. Conformational regulation of


CRISPR-associated nucleases. _Curr. Opin. Microbiol._ 37, 110–119 (2017). Article  CAS  Google Scholar  * Klompe, S. E. & Sternberg, S. H. Harnessing “A Billion Years of


Experimentation”: the ongoing exploration and exploitation of CRISPR–Cas immune systems. _CRISPR J._ 1, 141–158 (2018). Article  Google Scholar  * Koonin, E. V. Evolution of RNA- and


DNA-guided antivirus defense systems in prokaryotes and eukaryotes: common ancestry vs convergence. _Biol. Direct_ 12, 5 (2017). Article  Google Scholar  * Makarova, K. S. et al.


Evolutionary classification of CRISPR-Cas systems: a burst of class 2 and derived variants. _Nat. Rev. Microbiol._ 18, 67–83 (2020). Article  CAS  Google Scholar  * Pawluk, A., Davidson, A.


R. & Maxwell, K. L. Anti-CRISPR: discovery, mechanism and function. _Nat. Rev. Microbiol._ 16, 12–17 (2018). Article  CAS  Google Scholar  * Pawluk, A. et al. Inactivation of CRISPR-Cas


systems by anti-CRISPR proteins in diverse bacterial species. _Nat. Microbiol._ 1, 16085 (2016). Article  CAS  Google Scholar  * Chowdhury, S. et al. Structure reveals mechanisms of viral


suppressors that intercept a CRISPR RNA-guided surveillance complex. _Cell_ 169, 47–57 (2017). Article  CAS  Google Scholar  * Peng, R. et al. Alternate binding modes of anti-CRISPR viral


suppressors AcrF1/2 to Csy surveillance complex revealed by cryo-EM structures. _Cell Res._ 27, 853–864 (2017). Article  CAS  Google Scholar  * Guo, T. W. et al. Cryo-EM structures reveal


mechanism and inhibition of DNA targeting by a CRISPR-Cas surveillance complex. _Cell_ 171, 414–426 (2017). Article  CAS  Google Scholar  * Rollins, M. F., Schuman, J. T., Paulus, K.,


Bukhari, H. S. & Wiedenheft, B. Mechanism of foreign DNA recognition by a CRISPR RNA-guided surveillance complex from _Pseudomonas aeruginosa_. _Nucleic Acids Res._ 43, 2216–2222 (2015).


Article  CAS  Google Scholar  * Rollins, M. F. et al. Structure reveals a mechanism of CRISPR-RNA-guided nuclease recruitment and anti-CRISPR viral mimicry. _Mol. Cell_ 74, 132–142 (2019).


Article  CAS  Google Scholar  * Katoh, K., Rozewicki, J. & Yamada, K. D. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. _Brief


Bioinform_ 20, 1160–1166 (2019). Article  Google Scholar  * Zhang, K. et al. Inhibition mechanisms of AcrF9, AcrF8, and AcrF6 against type I-F CRISPR-Cas complex revealed by cryo-EM. _Proc.


Natl Acad. Sci. USA_ 117, 7176–7182 (2020). Article  CAS  Google Scholar  * Forsberg, K. J. et al. Functional metagenomics-guided discovery of potent Cas9 inhibitors in the human microbiome.


_eLife_ 8, e46540 (2019). Article  Google Scholar  * Rollins, M. F. et al. Cas1 and the Csy complex are opposing regulators of Cas2/3 nuclease activity. _Proc Natl Acad Sci USA_ 114,


E5113–E5121 (2017). Article  CAS  Google Scholar  * Wiedenheft, B. et al. RNA-guided complex from a bacterial immune system enhances target recognition through seed sequence interactions.


_Proc Natl Acad Sci USA_ 108, 10092–10097 (2011). Article  ADS  CAS  Google Scholar  * Rio, D. C. 5'-end labeling of RNA with [gamma-32P]ATP and T4 polynucleotide kinase. _Cold Spring


Harb Protoc_ 2014, 441–443 (2014). PubMed  Google Scholar  * Suloway, C. et al. Automated molecular microscopy: the new Leginon system. _J Struct Biol_ 151, 41–60 (2005). Article  CAS 


Google Scholar  * Tan, Y. Z. et al. Addressing preferred specimen orientation in single-particle cryo-EM through tilting. _Nat Methods_ 14, 793–796 (2017). Article  CAS  Google Scholar  *


Lander, G. C. et al. Appion: an integrated, database-driven pipeline to facilitate EM image processing. _J Struct Biol_ 166, 95–102 (2009). Article  CAS  Google Scholar  * Zheng, S. Q. et


al. MotionCor2: anisotropic correction of beam-induced motion for improved cryo-electron microscopy. _Nat Methods_ 14, 331–332 (2017). Article  CAS  Google Scholar  * Zhang, K. Gctf:


Real-time CTF determination and correction. _J Struct Biol_ 193, 1–12 (2016). Article  ADS  CAS  Google Scholar  * Voss, N. R., Yoshioka, C. K., Radermacher, M., Potter, C. S. &


Carragher, B. DoG Picker and TiltPicker: software tools to facilitate particle selection in single particle electron microscopy. _J Struct Biol_ 166, 205–213 (2009). Article  CAS  Google


Scholar  * Scheres, S. H. A Bayesian view on cryo-EM structure determination. _J Mol Biol_ 415, 406–418 (2012). Article  CAS  Google Scholar  * Punjani, A., Rubinstein, J. L., Fleet, D. J.


& Brubaker, M. A. cryoSPARC: algorithms for rapid unsupervised cryo-EM structure determination. _Nat Methods_ 14, 290–296 (2017). Article  CAS  Google Scholar  * Goddard, T. D., Huang,


C. C. & Ferrin, T. E. Software extensions to UCSF chimera for interactive visualization of large molecular assemblies. _Structure_ 13, 473–482 (2005). Article  CAS  Google Scholar  *


Heymann, J. B. & Belnap, D. M. Bsoft: image processing and molecular modeling for electron microscopy. _J Struct Biol_ 157, 3–18 (2007). Article  CAS  Google Scholar  * Nicholls, R. A.,


Long, F. & Murshudov, G. N. Low-resolution refinement tools in REFMAC5. _Acta Crystallogr D Biol Crystallogr_ 68, 404–417 (2012). Article  CAS  Google Scholar  * Afonine, P. V. et al.


Real-space refinement in PHENIX for cryo-EM and crystallography. _Acta Crystallogr D Struct Biol_ 74, 531–544 (2018). Article  CAS  Google Scholar  * Emsley, P. & Cowtan, K. Coot:


model-building tools for molecular graphics. _Acta Crystallographica Section D-Biological Crystallography_ 60, 2126–2132 (2004). Article  Google Scholar  * Williams, C. J. et al. MolProbity:


More and better reference data for improved all-atom structure validation. _Protein Sci_ 27, 293–315 (2018). Article  CAS  Google Scholar  * Goddard, T. D. et al. UCSF ChimeraX: Meeting


modern challenges in visualization and analysis. _Protein Sci_ 27, 14–25 (2018). Article  CAS  Google Scholar  Download references ACKNOWLEDGEMENTS The authors are grateful to Bill Anderson,


The Scripps Research Institute (TSRI) Electron Microscopy facility manager, and Jean-Christophe Ducom at TSRI High Performance Computing for support during EM data collection and


processing. The authors thank MaryClare Rollins and the rest of the Wiedenheft and Lander labs for critical feedback and discussion and Jack Nunberg and Ewelina Malecka-Grajek for generous


assistance with imaging. G.C.L. is supported as a Searle Scholar, a Pew Scholar, by a young investigator award from Amgen, and the National Institutes of Health (DP2EB020402). M.H. is


supported by the Dennis and Marsha Dammerman Fellowship of the Damon Runyon Cancer Research Foundation. A.S.-F. is a postdoctoral fellow of the Life Science Research Foundation, which is


supported by the Simons Foundation. Research in the Wiedenheft lab is supported by the National Institutes of Health (R35GM134867), a young investigator award from Amgen, the M. J. Murdock


Charitable Trust, and the Montana State University Agricultural Experimental Station (USDA NIFA). Computational analyses of EM data were performed using shared instrumentation at TSRI funded


by NIH S10OD021634. AUTHOR INFORMATION Author notes * These authors contributed equally: Marscha Hirschi, Wang-Ting Lu. AUTHORS AND AFFILIATIONS * Department of Integrative Structural and


Computational Biology, The Scripps Research Institute, 10550 North Torrey Pines Road, La Jolla, CA, 92121, USA Marscha Hirschi & Gabriel C. Lander * Department of Molecular Genetics, and


Department of Biochemistry, University of Toronto, 661 University Avenue, Room 1634, Toronto, ON, M5G 1M1, Canada Wang-Ting Lu & Alan R. Davidson * Department of Microbiology and


Immunology, Montana State University, 1156 South 11th Avenue, Bozeman, MT, 59717, USA Andrew Santiago-Frangos, Royce Wilkinson, Sarah M. Golden & Blake Wiedenheft Authors * Marscha


Hirschi View author publications You can also search for this author inPubMed Google Scholar * Wang-Ting Lu View author publications You can also search for this author inPubMed Google


Scholar * Andrew Santiago-Frangos View author publications You can also search for this author inPubMed Google Scholar * Royce Wilkinson View author publications You can also search for this


author inPubMed Google Scholar * Sarah M. Golden View author publications You can also search for this author inPubMed Google Scholar * Alan R. Davidson View author publications You can


also search for this author inPubMed Google Scholar * Gabriel C. Lander View author publications You can also search for this author inPubMed Google Scholar * Blake Wiedenheft View author


publications You can also search for this author inPubMed Google Scholar CONTRIBUTIONS M.H. conducted the electron microscopy experiments, single-particle 3D reconstruction, and model


building under the guidance of G.C.L. W.-T.L. observed the non-specific DNA binding capacity triggered by AcrIF9 under the guidance of A.R.D. A.S.-F., R.W., and S.M.G. purified the protein


samples and performed in vitro biochemical experiments under the guidance of B.W. M.H., A.S.-F., R.W., G.C.L., and B.W. wrote the manuscript. CORRESPONDING AUTHORS Correspondence to Alan R.


Davidson, Gabriel C. Lander or Blake Wiedenheft. ETHICS DECLARATIONS COMPETING INTERESTS B.W. is the founder of SurGene, LLC, and is an inventor on patent applications related to CRISPR-Cas


systems and applications thereof. A.R.D. is a scientific advisory board member for Acrigen Biosciences and is an inventor on patents relating to anti-CRISPR proteins. The other authors


declare no competing interests. ADDITIONAL INFORMATION PEER REVIEW INFORMATION _Nature Communications_ thanks Ning Jia, Malcolm White and the other, anonymous, reviewer(s) for their


contribution to the peer review of this work. Peer reviewer reports are available. PUBLISHER’S NOTE Springer Nature remains neutral with regard to jurisdictional claims in published maps and


institutional affiliations. SUPPLEMENTARY INFORMATION SUPPLEMENTARY INFORMATION PEER REVIEW FILE REPORTING SUMMARY SOURCE DATA SOURCE DATA RIGHTS AND PERMISSIONS OPEN ACCESS This article is


licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give


appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The images or other third party material in


this article are included in the article’s Creative Commons license, unless indicated otherwise in a credit line to the material. If material is not included in the article’s Creative


Commons license and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a


copy of this license, visit http://creativecommons.org/licenses/by/4.0/. Reprints and permissions ABOUT THIS ARTICLE CITE THIS ARTICLE Hirschi, M., Lu, WT., Santiago-Frangos, A. _et al._


AcrIF9 tethers non-sequence specific dsDNA to the CRISPR RNA-guided surveillance complex. _Nat Commun_ 11, 2730 (2020). https://doi.org/10.1038/s41467-020-16512-1 Download citation *


Received: 06 March 2020 * Accepted: 07 May 2020 * Published: 01 June 2020 * DOI: https://doi.org/10.1038/s41467-020-16512-1 SHARE THIS ARTICLE Anyone you share the following link with will


be able to read this content: Get shareable link Sorry, a shareable link is not currently available for this article. Copy to clipboard Provided by the Springer Nature SharedIt


content-sharing initiative